Csm1816 cryostat

For cryosections, larvae were processed as described.^{61 (link)} Larvae were cut as 16 μm sections on a Leica CSM1816 cryostat. For in situ hybridization, sections were hybridized as described^{62 (link)} with published antisense probes against collagen 2a1a^{63 (link)} or collagen 10a1a.^{64 (link)} Immunohistochemistry was performed as described^{62 (link)} without the proteinase K step, with mouse anti-PCNA (Proliferating Cell Nuclear Antigen; 1/500; Santa Cruz Biotech; PC10), Alexa Fluor 488 conjugated Donkey anti-mouse secondary antibody (1/100 Jackson Immunoresearch 715-545-150) and DAPI (1:2000 Life Technologies D1306). Fluorescence imaging was conducted on a Leica SP8 confocal microscope with a 63X oil immersion objective.

For cryosections, larvae were processed as described^{43 (link)}. Larvae were cut as 16 um sections on a Leica CSM1816 cryostat. For in situ hybridization (ISH), sections were hybridized as described^{43 (link)}. ISH probes were generated from RT-PCR amplified regions of CA col2a1a and col10a1a cDNAs using the following primers designed from published Maylandia zebra sequences: CA_col2a1aF: CTCAAGGCAAAGTTGGACCT, CA_col2a1aR: GACTCTCCTTTCTGTCCACG, CA_col10a1aF: GCAAGAGGATTTCAGGGTGA, CA_col10a1aR: GGCAATCAAGAACCCAGAGA. The amplified CA col2a1a fragment was 868bp long and over 99% identical to its M. zebra ortholog (Malawi cichlid reference genome, sequence ID XM_00454229.4). The amplified CA col10a1a fragment was 972bp long and over 99% identical to its M. zebra ortholog (Malawi cichlid reference genome, sequence ID XM_004566213.3). Immunohistochemistry was performed as described 62 without the proteinase K step, with mouse anti-PCNA (Proliferating Cell Nuclear Antigen; 1/500; Santa Cruz Biotech; PC10), Alexa Fluor 488 conjugated Donkey anti-mouse secondary antibody (1/100 Jackson Immunoresearch 715-545-150) and DAPI (1:2000 Life Technologies D1306). Fluorescence imaging was conducted on a Leica SP8 confocal microscope with a 63X oil immersion objective.