Macrobrachium carcinus specimens were from the Grijalva River, Centla, Tabasco, Mexico (latitude 18°14′11.9″ N, longitude 92°39′49.4″). All oligonucleotides were purchased from Integrated (DNA Technologies, Inc., Coralville, IA, USA). Escherichia coli DH5α, pGEM-T easy vector, RQ1 RNase-free DNase, SV Total RNA Isolation System, and GoTaq DNA polymerase were purchased from Promega (Madison, WI, USA). Luria-Bertani (LB) agar plates (1% tryptone, 0.5% yeast extract, 1% NaCl, 15 g/L agar, pH 7.0) with 100 µg/mL ampicillin was used for E. coli transformants selection. PfuUltra II Fusion HotStart DNA polymerase and AccuScript High-Fidelity Reverse Transcriptase were from Agilent Technologies (Santa Clara, CA, USA). RNAlater was from Life Technologies (Gaithersburg, MD, USA). All chemicals were of analytical grade and purchased from Sigma–Aldrich Co. (St. Louis, MO, USA) or from Productos Químicos Monterrey (Monterrey, Nuevo León, Mexico).
Pfuultra 2 fusion hotstart dna polymerase
Manufactured by Agilent Technologies
Sourced in United States, United Kingdom
The PfuUltra II Fusion HotStart DNA Polymerase is a thermostable DNA polymerase designed for high-fidelity DNA amplification. It exhibits 3'->5' exonuclease proofreading activity, resulting in increased accuracy during DNA synthesis compared to Taq DNA polymerase.
Automatically generated - may contain errors
Lab products found in correlation
Gblock, by Integrated DNA Technologies (2 mentions)
Rneasy mini kit, by Qiagen (2 mentions)
Gotaq dna polymerase, by Promega (1 mentions)
Escherichia coli dh5α, by Promega (1 mentions)
Rnalater, by Thermo Fisher Scientific (1 mentions)
Pgem t easy vector, by Promega (1 mentions)
Rq1 rnase free dnase, by Promega (1 mentions)
Sv total rna isolation system, by Promega (1 mentions)
Accuscript high fidelity reverse transcriptase, by Agilent Technologies (1 mentions)
Restriction enzyme, by New England Biolabs (1 mentions)
Hcas9, by Addgene (1 mentions)
Pspcas9 bb 2a puro px459 v2, by Addgene (1 mentions)
Aavs1 puro pgk1 3xflag twin strep, by Addgene (1 mentions)
Memerald sec61β, by Addgene (1 mentions)
Pmscarlet i c1, by Addgene (1 mentions)
Pentr d topo cloning kit, by Thermo Fisher Scientific (1 mentions)
Gateway lr clonase enzyme mix, by Thermo Fisher Scientific (1 mentions)
Quikchange 2 xl site directed mutagenesis kit, by Agilent Technologies (1 mentions)
Oligonucleotide, by Thermo Fisher Scientific (1 mentions)
Dneasy blood and tissue kit, by Qiagen (1 mentions)
12 protocols using pfuultra 2 fusion hotstart dna polymerase
1
Molecular analysis of Macrobrachium carcinus
2
Plasmid Construction Using PfuUltra II
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For plasmid construction, all PCRs were performed using PfuUltra II Fusion HotStart DNA polymerase (#600672, Agilent Technologies) and restriction enzymes were from New England Biolabs. The fragment DNA of tipA mutant construct was synthesized (gBlock, Integrated DNA Technologies).
3
LDAF1-FLAG-Seipin(1-310) Complex Expression
4
Cloning and Mutagenesis of Drosophila Constructs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PCR of the insert was performed using PfuUltra II Fusion Hotstart DNA Polymerase (Agilent Technologies, #600672), following the manufacturer’s protocol. Purified PCR product was cloned into an entry vector using the pENTR/D-TOPO Cloning Kit (Invitrogen, #K240020) and subsequently into a destination vector from the Drosophila Gateway vector collection system (Murphy laboratory, Carnegie Mellon University) using the Gateway LR clonase Enzyme mix (Invitrogen, #11791019).
Mutagenesis was performed using the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent, #200521) in an entry vector, which was then cloned into a destination vector for expression.
All final plasmids were verified by restriction analysis and sequencing of the insert. PCR template and primer sequences are provided in Supplementary Table5 .
Mutagenesis was performed using the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent, #200521) in an entry vector, which was then cloned into a destination vector for expression.
All final plasmids were verified by restriction analysis and sequencing of the insert. PCR template and primer sequences are provided in Supplementary Table
5
Site-directed mutagenesis and protein expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Site-directed mutagenesis was performed according to the manufacturer's instructions, using the PfuUltraII Fusion HotStart DNA Polymerase (Agilent # 600670) and pBluescriptIISK+ containing the relevant DNA as a template. Primers used are listed in Table 2 . Then, the DNA was cloned to the vector of interest, using the BstEII (NEB # R3162S) and BlpI (NEB # R0585S) restriction enzymes for HOG1 and the EcoRI (NEB #R3101S) restriction enzyme for p38α. All HOG1 molecules were expressed from the pES86 vector as N-terminal 3X-HemeAgluttinin (3XHA)-tagged proteins, as described previously [35 (link)]. Native HOG1 and various derivatives were sub-cloned between the ADH1 promoter and terminator. The pES86 vector further harbours the URA3 gene and the 2μ-element. For mammalian expression, the pcDNA3 (Startagene) and pBabe (Addgene) vectors were used with the ORFs tagged N-terminally with 3XHA. For bacterial expression, the pET15b vector was used, with the ORFs hexahistidine-tagged N-terminally, as described previously [26 (link),28 (link),29 (link)].
6
Multilocus Sequence Typing of Enterococcus faecalis
7
Generating Na_V_Ab Mutant Plasmids
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The pFastBac-NaVAbΔ28 plasmid carrying a C-terminal 28-residue truncation (residues 1–239) of NaVAb gene (Gamal El-Din et al., 2019 (link)) was used as a template for site-directed mutagenesis. To generate a desired plasmid of a NaVAb mutant, overlapping oligonucleotide primers with a codon changed to a specific mutation were synthesized (Integrated DNA Technologies) and used for site-directed mutagenesis PCR with PfuUltra II Fusion HotStart DNA Polymerase (Agilent). The PCR products were treated with DpnI (New England Biolabs) and transformed into E. coli GC10 competent cells (Genesee Scientific). Plasmid DNAs were isolated from transformed colonies using the QIAprep Spin Miniprep Kit (Qiagen) according to the manufacturer’s protocol and sequenced to confirm the mutation. Plasmids containing NaVAbΔ28 with the IEM mutation were used to transform E. coli DH10Bac competent cells for bacmid production, and baculoviruses were prepared with Sf9 insect cells using the Bac-to-Bac protocol according to the manufacturer (Life Technologies). All baculoviruses were tested for protein expression in Hi5 insect cells and the expression levels were confirmed by Western blot analysis to be consistent for all mutants. The same batches of baculoviruses were used for both electrophysiology and protein purification experiments.
8
Deletion of CBU1823 gene in C. burnetii
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A PCR product consisting of CBU1823 and 2 kb of DNA flanking either end was amplified from C. burnetii (Nine Mile RSA 493 phase II) genomic DNA by using PfuUltra II Fusion HotStart DNA polymerase (Agilent Technologies). The product was ligated into the BamHI and SalI sites of pJC-CAT. The resulting construct, pJC-1823FL, was then used as a template in a PCR. The resulting PCR product was then gel purified and digested with NotI-HF (New England Biolabs) and ligated with the kanamycin resistance gene amplified from pJB-Kan. The ligation mix was then transformed into DH5α. The resulting construct, pJC1823KO, in which the CBU1823 gene was replaced with a kanamycin resistance gene, was then used in the gene knockout experiment66 (link). CBU1823 knockout was confirmed by Southern hybridization using probes directly binding to CBU1823 and the kanamycin resistance cassette.
9
Genomic DNA Extraction and In Vitro Transcription
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was isolated using the DNeasy Blood & Tissue Kit (Qiagen, #69504). PCR was performed using primers containing the T7 promoter sequence (on both forward and reverse primers) with PfuUltra II Fusion Hotstart DNA Polymerase (Agilent Technologies, #600672). PCR products with the expected size were separated on a 1% agarose gel, and the MEGAscript T7 Transcription Kit (Invitrogen, #AM1334) was used for in vitro transcription. RNA was purified using the RNeasy Mini Kit (Qiagen, #74104). Primer sequences are provided in Supplementary Table 6 .
10
Amplification and Sequencing of EGFR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using the QIAGEN RNeasy Mini Kit (QIAGEN) and reverse transcribed with SuperScript III Reverse Transcriptase (Invitrogen). Full-length EGFR was amplified using high-fidelity PfuUltra II Fusion HotStart DNA Polymerase (Agilent Technologies) with the following primers: upstream, GCCAAGGCACGAGTAACAAGC; downstream, GCTTTGTGGCGCGACCCTTAG. The PCR product was purified using the QIAquick PCR Purification Kit (QIAGEN) before sequencing by Eurofins Genomics. Sequencing primers are listed in Supplemental Table 3 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!