The target sequences of AURKA siRNAs (GenePharma) were as follows: 1, 5′-ATGCCCTGTCTTACTGTCA-3′; 2, 5′-GGCAACCAGTGTACCTCAT-3′; and 3, 5′-ATTCTTCCCAGCGCGTTCC-3′. The target sequence of hnRNP K siRNA (GenePharma) was 5′-AATATTAAGGCTCTCCGTACA-3′ and the negative control siRNA sequence was 5′-TTCTCCGAACGTGTCACGT-3′. The shAURKA (TRC number: TRCN0000000655) and sh control (SHC002) plasmids were purchased from Sigma-Aldrich. The shRNA sequences against hnRNP K (sense: 5′-CGCGTCCCCGTTATTGTTGGTGGTTTAATTCAAGAGATTAAACCACCAACAATAACTTTTTGGAAAT-3′ and antisense: 5′-CGATTTCCAAAAAGTTATTGTTGGTGGTTTAATCTCTTGAATTAAACCACCAACAATAACGGGGA-3′) were cloned into pLVTHM (Addgene).
Sh control shc002
Manufactured by Merck Group
SHC002 is a lab equipment product manufactured by Merck Group. It is a device used for the control and monitoring of humidity and temperature in laboratory settings. The core function of SHC002 is to provide precise and consistent environmental conditions for sensitive experiments and processes.
Automatically generated - may contain errors
Lab products found in correlation
Aurka sirnas, by GenePharma (1 mentions)
Shaurka, by Merck Group (1 mentions)
Plvthm, by Addgene (1 mentions)
Plko tet on system, by Merck Group (1 mentions)
Pcdna3.1 v5 his topo, by Thermo Fisher Scientific (1 mentions)
Vsv g pmd2 g, by Addgene (1 mentions)
X tremegene 9, by Roche (1 mentions)
Pmd2 g and pspax2, by Addgene (1 mentions)
Puromycin, by Thermo Fisher Scientific (1 mentions)
Polybrene, by Merck Group (1 mentions)
Shmed12, by Merck Group (1 mentions)
Shsdc2, by Merck Group (1 mentions)
Shyap1, by Merck Group (1 mentions)
5 protocols using sh control shc002
1
Knockdown of AURKA and hnRNP K
2
TRIM29 Gene Knockdown Using shRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The shTRIM29#1 (TRC number: TRCN0000016348), shTRIM29#2 (TRCN0000016350), and sh‐control (SHC002) plasmids were purchased from Sigma‐Aldrich. Inducible knockdown of the TRIM29 gene was carried out with the specific shRNAs delivered by a pLKO‐Tet‐On system (Sigma‐Aldrich) according to the instruction manual. The target sequences were: pLKO‐Tet‐On shGFP sense, CAAGCTGACCCTGAAGTTCAT; and antisense, ATGAACTTCAGGGTCAGCTTGC. pLKO‐Rb‐shRNA and pLKO‐p53‐shRNA were purchased from Addgene. The shRNA sequences against VDAC1 (sense, 5′‐GCTTGGTCTAGGACTGGAATT‐3′ and antisense, 5′‐AATTCCAGTCCTAGACCAAGC‐3′; and sense, 5′‐GCAGTTGGCTACAAGACTGAT‐3′ and antisense, 5′‐ATCAGTCTTGTAGCCAACTGC‐3′) were cloned into pLKO‐Tet‐On.
3
Cloning and Generating EPC1 Constructs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The cDNA encoding full-length EPC1 was amplified by PCR based on the information available from NCBI database (accession number NM_025209.3), cloned into pcDNA3.1/V5-His TOPO (Invitrogen), and verified by sequencing. Adenoviral plasmid encoding EPC1 was constructed by cutting cDNA from pcDNA3.1/EPC1 usingPmeI and HindIII restriction sites and cloning into pAdTrack-CMV. Recombinant adenovirus was generated by cotransfection of pAdTrack-CMV-EPC1 and pAdEasy-1 as previously described (36 (link)). Lentiviral plasmids (pLKO.1-puro) encoding sh.E2F1 (clone ID: TRCN250, TRCN253), sh.EPC1 (clone ID: TRCN263, TRCN264) and sh.control (SHC002) were purchased from Sigma–Aldrich. VSV-G enveloped pseudotyped lentiviral vectors were generated in HEK293T packaging cells by cotransfection with pLKO.1 plasmid containing shRNA sequences, pAX2 and VSV-G/pMD2.G (Addgene) using calcium phosphate method. Media were replaced 8 h after transfection, and 48 h later conditioned media were harvested and filtered.
4
Lentiviral Transduction of mNS-5 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
shRNA transfer vectors were purchased from Sigma (Sigma; catalog numbers: shControl- SHC002, shMed12- TRCN0000096467, shCdk8- TRCN0000023107, shCyclinC- TRCN0000077830, shMed1- TRCN0000099578, shLamc1- TRCN0000055420, shSdc2- TRCN0000311814, Itgb5- TRCN0000067123). Each lentiviruses were produced by transient cotransfection of HEK293T cells with shRNA transfer vectors with pMD2G and psPAX2 (AddGene) using X-tremeGENE9 (Roche Applied Science). For lentivirus infection, mNS-5 cells were seeded in 60 mm tissue culture plate at a density of 1 × 106 cells per plate. Twenty-four hours later, cells were infected with lentiviruses in the presence of 8 μg/ml of polybrene (Millipore). Twenty-four hours after lentivirus infection, the medium was removed and replaced with fresh medium containing 600 ng/ml puromycin (Gibco) for selection.
5
Bioluminescence Tracking and YAP Inhibition
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For bioluminescent tracking, MTOs were infected with a lentivirus encoding an EGFP-firefly luciferase fusion reporter construct under the control of the PGK promoter. For YAP inhibition experiments, AKTP organoids were infected with shControl (SHC002) or shYAP1 (TRCN0000095864, TRCN0000095865, TRCN0000095866, TRCN0000095867) Mission Sigma-Aldrich lentiviral constructs. We also use a pInducer20 EGFP-TEADi vector, a gift from Ramiro Iglesias-Bartolome (Addgene plasmid # 140145 ; http://n2t.net/addgene:140145 ; RRID:Addgene_140145), that blocks the activity of both YAP and TAZ 33 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!