HBMECs and macrophages were infected with DENV-2, in the presence or absence of N-acetylcysteine. After 48hpi, cell lysates and supernatants were harvested and RNA was isolated using TRIZOL reagent (Life Technologies), according to the manufacturer’s instructions. First strand cDNA was synthesized using 2 µg RNA using High-Capacity cDNA Archive Kit (Life Technologies), according to the manufacturer’s instructions. Quantitative real-time PCR was performed using a StepOnePlus Real-time PCR system (Life Technologies) and Taqman Master Mix Reagents (Life Technologies), as described before (9 (link)).
Taqman master mix reagent
Manufactured by Thermo Fisher Scientific
Sourced in United States
The TaqMan Master Mix reagent is a ready-to-use solution designed for quantitative real-time PCR (qPCR) applications. It contains all the necessary components for efficient amplification and detection of target DNA or RNA sequences, including DNA polymerase, dNTPs, and buffer. The reagent is optimized for use with TaqMan probes, providing reliable and sensitive results.
Automatically generated - may contain errors
Lab products found in correlation
Quantstudio 6 real time pcr system, by Thermo Fisher Scientific (3 mentions)
High capacity cdna archive kit, by Thermo Fisher Scientific (2 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (2 mentions)
Taqman copy number assay, by Thermo Fisher Scientific (2 mentions)
7500 sequence detection system, by Thermo Fisher Scientific (2 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Trizol reagent, by Merck Group (1 mentions)
Taqman master mix, by Thermo Fisher Scientific (1 mentions)
7500 real time pcr system, by Thermo Fisher Scientific (1 mentions)
7 protocols using taqman master mix reagent
1
DENV-2 Infection Quantification
2
ZIKV Viral Load Quantification by qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Viral load on mouse tissues (brain, spleen, gut, liver, and kidney) or splenocytes specific cell populations was assessed by qRT-PCR. RNA was isolated using TRIZOL reagent (Sigma-Aldrich), and the synthesis of cDNA was performed using high-capacity cDNA Archive Kit (Life Technologies), following the manufacturer’s instructions. The cDNAs obtained were subjected to qRT-PCR using a StepOnePlus Real-time PCR system (Life Technologies) and Taqman Master Mix Reagents (Life Technologies). The primers and probe applied for viral load evaluation were specific for the E sequences, as follow: ZIKV 1086 5′-CCGCTGCCCAACACAAG-3′; ZIKV 1162c 5′-CCACTAACGTTCTTTTGCAGACAT-3′; ZIKV 1107-FAM 5′-AGCCTACCTTGACAAGCAGTCAGACACTCAA-3′62 (link). Standard curve was performed using cDNAs obtained from virus samples stocks, ranging from 75,000 to 0.75 PFU/mL, to estimate the genome copy number of ZIKV (RNA equivalent). Samples were deemed false if the cycle threshold cutoff value of 30 was exceeded. Interest genes expression was normalized using the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase.
3
Quantification of Lentiviral Integrations
4
Quantification of Lentiviral Integrations
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For quantification of lentiviral integrations in transduced cells we used a custom-designed Taqman copy number assay (Invitrogen) to detect the Pac (puroR) gene. Amplification was conducted on QuantStudio 6 Real-Time PCR system (Applied biosystems), using Taqman master mix reagent (Applied biosystems) and specific primers and probe (forward-5’GCGGTGTTCGCCGAGAT; reverse-5’GAGGCCTTCCATCTGTTGCT; probe (FAM) CCGGGAACCGCTCAACTC)
5
Quantification of PTPRK–RSPO3 Inversions
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For quantification of PTPRK–RSPO3 inversions in complex tissue and organoids: Taqman PCR was conducted on QuantStudio 6 Real-Time PCR system (Applied biosystems), using Taqman master mix reagent (Applied biosystems) and specific primers and probe (Supplementary Data 5 ).
6
Differential Expression of MicroRNAs via Real-Time PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The real-time PCR method was used for the differential expression of the microRNA. From the cDNA obtained from the samples, real-time quantitative Polymerase Chain Reaction (PCR) amplification (RQ-PCR) was performed using the TaqMan Master Mix reagent (Applied Biosystems). The commercially available TaqMan Assayon-demand system, composed of oligonucleotides and probes (Applied Biosystems), was used for the quantitative analysis of microRNA expression. The data were then exported to Excel spreadsheets to calculate the DCT values.
The GraphPad Prism 8.0 software (GraphPad Prism, Inc, San Diego, CA, USA) was used to generate the graphs and calculate the statistical significance. All reactions were performed in duplicate and analyzed on the 7500 Sequence Detection System (Applied Biosystems). The data were constantly collected during the PCR and analyzed in ABI-7500 SDS "software package".
Statistical analysis. The Kruskal-Wallis test, followed by the Bonferroni post-test, was performed using the GraphPad Prism software (GraphPad Software, San Diego, CA, USA). The level of significance was set at p <0.05 for two-tailed tests.
The GraphPad Prism 8.0 software (GraphPad Prism, Inc, San Diego, CA, USA) was used to generate the graphs and calculate the statistical significance. All reactions were performed in duplicate and analyzed on the 7500 Sequence Detection System (Applied Biosystems). The data were constantly collected during the PCR and analyzed in ABI-7500 SDS "software package".
Statistical analysis. The Kruskal-Wallis test, followed by the Bonferroni post-test, was performed using the GraphPad Prism software (GraphPad Software, San Diego, CA, USA). The level of significance was set at p <0.05 for two-tailed tests.
7
Real-Time qRT-PCR Analysis of miRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A real-time PCR was used to confirm the differential expression. From the obtained cDNA samples, a real-time quantitative reverse transcriptase polymerase chain reaction (RQ-PCR) was performed using the TaqMan Master Mix (Applied Biosystems). Quantitative analysis of the expression was carried out using the TaqMan Assay Kit (Assays-on-demand) (Applied Biosystems).
Relative quantification of microRNAs was performed using TaqMan Master Mix® reagent (Applied Biosystems, USA). The real-time PCR reactions were carried out in duplicate.
Amplification was performed in a final volume of 10μl (5μl of TaqMan Master Mix®, 0,5μl of each specific probe and 4,5μl of cDNA). CT values were obtained using the 7500 Real-Time PCR System® (Applied Biosystems, USA) and the Sequence Detection System® software. ΔCT values were calculated using Microsoft® Excel® calculation. Statistical analysis and graphics generation were carried out using the GraphPad Prism 6.0® software (GraphPad Prism Inc., San Diego, CA, USA).
Standard amplification conditions were 95°C for 10 minutes, followed by 40 cycles of 95°C for 15 seconds and 60°C for 1 minute (annealing and simultaneous extension). All reactions were performed in duplicate and analyzed in the 7500 Sequence Detection System® (Applied Biosystems, USA). During the PCR data were continuously collected and analyzed in ABI-7500 SDS software.
Relative quantification of microRNAs was performed using TaqMan Master Mix® reagent (Applied Biosystems, USA). The real-time PCR reactions were carried out in duplicate.
Amplification was performed in a final volume of 10μl (5μl of TaqMan Master Mix®, 0,5μl of each specific probe and 4,5μl of cDNA). CT values were obtained using the 7500 Real-Time PCR System® (Applied Biosystems, USA) and the Sequence Detection System® software. ΔCT values were calculated using Microsoft® Excel® calculation. Statistical analysis and graphics generation were carried out using the GraphPad Prism 6.0® software (GraphPad Prism Inc., San Diego, CA, USA).
Standard amplification conditions were 95°C for 10 minutes, followed by 40 cycles of 95°C for 15 seconds and 60°C for 1 minute (annealing and simultaneous extension). All reactions were performed in duplicate and analyzed in the 7500 Sequence Detection System® (Applied Biosystems, USA). During the PCR data were continuously collected and analyzed in ABI-7500 SDS software.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!