The largest database of trusted experimental protocols

3 protocols using α tubulin rabbit mab

1

Visualizing Intracellular Protein Localization

Check if the same lab product or an alternative is used in the 5 most similar protocols
To visualize intracellular proteins, immunofluorescence staining was applied using primary antibodies and appropriate fluorescent secondary antibodies. The following primary antibodies were used: Acetyl-alpha Tubulin (Lys40) mouse mAb (1:100, Thermo Fisher Scientific), α-tubulin rabbit mAb (1:100, Cell signaling technology), GM-130 rabbit mAb (1:100, Cell signaling technology), Pericentrin rabbit pAb (1:100, Abcam), Hsp60 rabbit mAb (1:100, Cell signaling technology). The following secondary antibodies were used: Alexa Fluor 594 goat anti-mouse IgG (1:200, Thermo Fisher Scientific, A-11032), Alexa Fluor 488 goat anti-rabbit IgG (1:200, Thermo Fisher Scientific, A-11008). Nuclei were stained with DAPI. The LSM710 system (Carl Zeiss) with a Plan Apochromat 63 × /1.40-NA oil DICIII objective lens (Carl Zeiss) was used to acquire images.
+ Open protocol
+ Expand
2

Quantitative Immunoblotting for Protein Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total protein was collected by lysing adherent cells with RIPA buffer (Sigma, cat. #R0278) supplemented with phosphatase and protease inhibitors (Thermo Scientific, cat. #78440). Protein concentration was measured using the Bradford reagent (Thermo Scientific, cat. #23236). An equal amount of protein was loaded for immunoblotting. After electrophoresis, the protein was transferred to the PVDF transfer membrane (Merck, cat. #0000240973), followed by a 5% BSA blocking buffer, and incubated overnight with primary antibodies. After washing with TBST (TBS with .1% Tween), anti‐rabbit second antibodies (Cell Signaling Technology, cat. #7074) conjugated with HRP‐conjugated were used to probe the membranes. Samples were developed by Chemiluminescent Substrate (Thermo Scientific, cat. #34577) and exposed by Tanon 5200 Multi‐system (Tanon Co.). Densitometry was performed using ImageJ software (National Institutes of Health), and samples were normalized to internal controls. Primary antibodies used in this study are CDK12 antibody (Cell Signaling Technology, cat. #11973), Phospho‐Rpb1 CTD (Ser2/Ser5) Rabbit mAb (Cell Signaling Technology, cat. #13546), β‐Actin Rabbit mAb (Cell Signaling Technology, cat. #8457), GAPDH Rabbit mAb (Cell Signaling Technology, cat. #2118), α‐Tubulin Rabbit mAb (Cell Signaling Technology, cat. #2125) and recombinant Anti‐FACL4 antibody (Abcam, cat. #EPR8640).
+ Open protocol
+ Expand
3

Quantification of Transgenic Mosquito Testes

Check if the same lab product or an alternative is used in the 5 most similar protocols
Mosquito abdomens were dissected and 10 pairs of testis from each transgenic line were pooled to constitute a biological replicate for total RNA and protein extraction using TRI reagent (Ambion). RNA was reverse-transcribed using Superscript II (Invitrogen) after TURBO DNA-free (Ambion) treatment following the manufacturer’s instructions. Quantitative real-time PCRs (qRT-PCR) were performed on cDNA using the Fast SYBR-Green master mix on a StepOnePlus system (Applied Biosystems). Ribosomal protein Rpl19 gene was used for normalization. At least two independent biological replicates from independent crosses were subjected to duplicate technical assays. We used primers RPL19Fwd (CCAACTCGCGACAAAACATTC), RPL19Rev (ACCGGCTTCTTGATGATCAGA), eGFP-F (CGGCGTGCAGTGCTTCA) and eGFP-R (CGGCGCGGGTCTTGT). For the western blot analysis proteins were separated under denaturing conditions (SDS-PAGE) on 4–15% precast gels (Criterion TGX, Bio-Rad) and subsequently transferred to Hybond ECL membranes (Amersham). Immunoblotting was performed with α-GFP Rabbit mAb and α-Tubulin Rabbit mAb (Cell Signaling) at a 1:1000 dilution and a 1:1000 α-rabbit IgG HRP-linked secondary antibody (Cell Signaling) using the Pierce SuperSignal West Femto Substrate (Thermo Scientific). Chemiluminescence signals were recorded using a Bio-Rad ChemiDoc XRS+ system and quantified using Bio-Rad Image Lab software.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!