Electrophoresis system

Marker polymorphisms were visualized after electrophoresis through a 1.5 % agarose gel (ag × arose dissolved in 1× TBE buffer with 0.015 μL ethidium bromide mL⁻¹) on an OWL AG electrophoresis system (Thermo Scientific, Waltham, MA, USA). Each sample for electrophoresis contained 6.5 μL sterile H₂O, 3.5 μL of loading dye buffer (6× DNA Loading Dye, Fermentas), and 2 μL of PCR product. A DNA ladder (GeneRuler 100 bp DNA Ladder) was used as a product length indicator. The electrophoretic parameters were 5 V/cm, 3.5 mA/cm, and 0.4 W/cm. Gel visualization was carried out twice, after 1 and 2.5 h (Molecular Imager® ChemiDoc™ XRS System, BioRad).
Ambiguous results were analyzed again in denaturing conditions using a denaturing sequencing gel. The gel (96 mL) contained 60.8 mL 5 M urea, 9.6 mL 10× TBE buffer, 9.6 mL 40 % acrylamide with bisacrylamide (39:1), 150 μL APS, and 40 μL TEMED. The gels were subject to 30 min of pre-electrophoresis, after which DNA samples were denatured (95 °C, 5 min, 0 °C, 3 min) with formamide dye (in 1:1 volume) and loaded onto the gel in a 1.2-μL volume. The electrophoretic parameters were 1 h 15 min, 45 V/cm, 1.3 W/cm, 2.2 mA/cm. Visualization was carried out using the silver-staining method (Chalhoub et al. 1997 (link)).

Conventional PCR for detection of D. fragilis was performed using primers DF400 (5′–TATCGGAGGTGGTAATGACC–3′) and DF1250 (5′–CATCTTCCTCCTGCTTAGAC–3′) which amplify the ∼850 bp region of SSU rDNA [16 (link)]. PCR was performed in the T100TM Thermal Cycler (Biorad, Hercules, CA, USA) under the following conditions: 95 °C/5 min, 34 × (94 °C/1 min; 58 °C/1,5 min; 72 °C/2 min), and 72 °C/10 min. All PCR reactions were prepared in a final volume of 10 μL containing 5 μL of commercially produced 2× concentrated Master Mix (AccuPowerR Taq PCR PreMix; Bioneer, Daejeon, Republic of Korea), 1 μL of each primer, 1 μL of MiliQ water and 2 μL of template DNA. PCR products were visualized by electrophoresis, loading 8 μL of PCR product on a 1% agarose gel with ethidium bromide using the Thermo Fisher Scientific electrophoresis system (Waltham, MA, USA).