Invitrogen superscript 3 reverse transcriptase kit

For preparing the cDNA library, total RNA from 7-week-old radish roots was isolated using the QIAGEN RNeasy^® Plant Mini kit (Qiagen Cat No./ID: 74903). For the cDNA library preparation, a reverse-transcription reaction was carried out using 1μg of the total RNA with the Invitrogen™ SuperScriptIII reverse transcriptase kit (Thermo Fisher Scientific, Cat No.180800930) following the manufacturer's instruction.

Total DNA was extracted from quarter membranes using the DNeasy^® PowerWater^® Kit (Qiagen) according to the manufacturer’s protocol with some modifications. After 10 min at 65°C, a mechanical cell lysis was carried out using the Precellys^® 24 bead beater (Bertin Technologies) and the following programme: 4 lysis cycles of 20 s at 5000 r.p.m., with 5 s of pause between each cycle. DNA was eluted in 50 µl of the elution solution provided in the kit, and samples were stored at 4°C until being tested by real‐time PCR.
Total RNA was extracted from quarter membranes using the RNeasy^® PowerWater^® Kit (Qiagen) according to the manufacturer’s protocol with some modifications. Mechanical cell lysis was carried out as described above for DNA extraction. Nucleic acid was eluted in 50 µl of the elution solution provided in the kit. Genomic DNA was removed using the DNase™ Max Kit (Qiagen) following the manufacturer’s recommendations, except that DNase reaction was performed at 37°C for 30 min instead of 20 min. The successful elimination of genomic DNA was checked by testing RNA extracts directly by real‐time PCR targeting Bonamia ostreae 18S rDNA (see below).
cDNAs were synthesized using the Invitrogen™ SuperScript™ III Reverse Transcriptase kit (Thermo Fisher Scientific), following the manufacturer’s instructions. cDNAs were stored at 4°C until being tested by real‐time PCR.

Total RNA was extracted from using MiniBEST Universal RNA Extraction Kit (TaKaRa, Beijing, China) following manufacturer’s manual. First strand cDNA was synthesized from 0.5 µg total RNA using Invitrogen SuperScript III Reverse Transcriptase kit (ThermoFisher, Shanghai, China). Noncoding small RNAs were first poly (A) tailed with E. coli Poly(A) Polymerase (M0276, NEB, Ipswich, MA) and then reverse transcribed using Moloney Murine Leukemia Virus (M-MuLV, MMLV) Reverse Transcriptase (M0253, NEB) with GTCGCAGTGCAGGGTCCGAGGTGGCGATTTTTTTTTTTTTTTTTTTTTTT(A/G/C)(A/G/T/C) as primer. Real-time RT-PCR amplication was carried on an ABI StepOne Plus (Applied Biosystems, Foster City, CA) using SYBR Premix Ex TaqTM kit (Takara, Beijing, China). The PCR primers were TGCTGTGTGCCAATGTTTCG and CAGCTGCCTGCTGTTTTCTG for MALAT1, CTGCTTCCTACATCGTAAGTGCAA and TTGCTCCCTCCAAATGCTGGT for enhancer of zeste 2 polycomb repressive complex 2 subunit (EZH2), CTGAGGAGCAGCTTCAGTCC and GAGTAGCCATTGTCCACGCT for β-catenin (CTNNB1), and CCGAGAATGGGAAGCTTGTC and AAGCACCAACGAGAGGAGAA for glyceraldehyde 3-phosphate dehydrogenase (GAPDH). TAAGGCACGCGGTGAATGC for miR-124-3p and CGCAAGGATGACACGCAAATTC for U6 with universal reverse primer GTGCAGGGTCCGAGGT. The relative gene expression was calculated using 2^− ΔΔCt method with GAPDH as internal control for lncRNA MALAT1 and EZH2 while U6 for miR-124-3p.