A volume of 2 ml of the culture was centrifuged at 16,000 g for 10 min at 4 °C in a refrigerated benchtop microcentrifuge. The supernatant was discarded and the cells pellet was resuspended in 600 μL of Nuclei Lysis Solution supplied by Promega Wizard Genomic DNA purification kit (Promega Corporation, Madison, USA). Total DNA extraction was performed using Promega Wizard Genomic DNA purification kit according to manufacturer instructions. DNA quantity and quality were determined using Nanodrop ND-1000 spectrophotometer (NanoDrop Tech, Wilmington, DE), Qubit 2.0 fluorometer (Invitrogen, Life Technologies, CA, USA) and 0.8% agarose gel electrophoresis. Each extraction yielded at least 5 μg of high-quality genomic DNA.
Wizard genomic dna purification kit
Manufactured by Promega
Sourced in United States, France, Germany, China, United Kingdom, Japan, Switzerland, Australia, Italy, Spain, Ireland, Canada, Brazil
The Wizard Genomic DNA Purification Kit is a product designed to isolate and purify genomic DNA from a variety of sample types. It utilizes a simple, rapid, and efficient protocol to extract high-quality DNA that can be used in various downstream applications.
Automatically generated - may contain errors
Lab products found in correlation
Nanodrop, by Thermo Fisher Scientific (61 mentions)
Nanodrop spectrophotometer, by Thermo Fisher Scientific (55 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (50 mentions)
Nanodrop nd 1000 spectrophotometer, by Thermo Fisher Scientific (48 mentions)
Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (46 mentions)
Qubit 2.0 fluorometer, by Thermo Fisher Scientific (41 mentions)
Miseq platform, by Illumina (41 mentions)
Hiseq 2500, by Illumina (35 mentions)
Hiseq 2000, by Illumina (33 mentions)
Nanodrop 1000 spectrophotometer, by Thermo Fisher Scientific (31 mentions)
Trizol reagent, by Thermo Fisher Scientific (30 mentions)
Nanodrop 1000, by Thermo Fisher Scientific (26 mentions)
Qubit fluorometer, by Thermo Fisher Scientific (26 mentions)
Bigdye terminator v3.1 cycle sequencing kit, by Thermo Fisher Scientific (25 mentions)
Qubit 3.0 fluorometer, by Thermo Fisher Scientific (23 mentions)
Qiaquick pcr purification kit, by Qiagen (22 mentions)
Qubit dsdna hs assay kit, by Thermo Fisher Scientific (20 mentions)
Ez dna methylation gold kit, by Zymo Research (19 mentions)
Epitect bisulfite kit, by Qiagen (18 mentions)
Lysozyme, by Merck Group (18 mentions)
2 764 protocols using wizard genomic dna purification kit
1
Genomic DNA Extraction from Bacterial Cultures
2
DNA Extraction from Blood and Ticks
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA extraction from blood samples was conducted within 24 h of collection using the Wizard Genomic DNA Purification Kit (Promega, Madison, WI, USA) following the manufacturer’s instructions. The DNA samples were eluted in 100 µL of DNA Rehydration Solution and stored at −80 °C until they were used as templates for polymerase chain reaction (PCR) assays.
For tick samples, one female tick per animal was selected from the total collected during the last three sampling sessions for total DNA extraction. Ticks were homogenized using a MagNA Lyser instrument (Roche Molecular Diagnostics, Rotkreuz, Switzerland) at a speed of 5000 rpm for 5 cycles of 60 s each. During homogenization, 50 μL of PBS (Sigma, St. Louis, MO, USA) were added to a MagNA Lyser tube containing ceramic beads. The tick homogenates were then subjected to total DNA extraction using the Wizard Genomic DNA Purification Kit (Promega, Madison, WI, USA) according to the manufacturer’s instructions. The DNA samples were eluted in 60 µL of DNA Rehydration Solution. The quantitative and qualitative assessment of DNA extraction was performed using a Colibri Microvolume Spectrophotometer (Titertek-Berthold, Pforzheim, Germany). All extracted DNA samples were stored at −80 °C until they were used.
For tick samples, one female tick per animal was selected from the total collected during the last three sampling sessions for total DNA extraction. Ticks were homogenized using a MagNA Lyser instrument (Roche Molecular Diagnostics, Rotkreuz, Switzerland) at a speed of 5000 rpm for 5 cycles of 60 s each. During homogenization, 50 μL of PBS (Sigma, St. Louis, MO, USA) were added to a MagNA Lyser tube containing ceramic beads. The tick homogenates were then subjected to total DNA extraction using the Wizard Genomic DNA Purification Kit (Promega, Madison, WI, USA) according to the manufacturer’s instructions. The DNA samples were eluted in 60 µL of DNA Rehydration Solution. The quantitative and qualitative assessment of DNA extraction was performed using a Colibri Microvolume Spectrophotometer (Titertek-Berthold, Pforzheim, Germany). All extracted DNA samples were stored at −80 °C until they were used.
3
Genotyping of Gastric Cancer Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA from gastric tumour and nontumour tissues was extracted using a Wizard® Genomic DNA Purification Kit (Promega, Madison, WI, USA) and QuickGene™ DNA Tissue Kit S (Fujifilm Corporation, Tokyo, Japan) on QuickGene-810 DNA isolation system (Fujifilm) according to manufacturer’s protocol. Genomic DNA from control population was extracted from peripheral blood samples using Wizard® Genomic DNA Purification Kit (Promega) following the manufacturer’s protocol. The DNA was quantified using a NanoDrop spectrophotometer (Thermo Fisher Scientific Inc.). Genotyping for polymorphism rs151658 (C>G) in TTK gene, and polymorphisms rs1031963 (C>T) and rs1801376 (A>G) in BUB1B gene was performed using TaqMan-based allele-specific polymerase chain reaction assays on the ABI Prism 7000 Sequencing Detection System apparatus (Applied Biosystems, Foster City, CA, USA) according to the procedure recommended by Applied Biosystems. The 10 μL reaction volume contained 100 ng of DNA. Assay IDs were: C_3181603_10, C_1237153_10, and C_3052718_1. In order to confirm the veracity of the results, the polymorphisms were re-genotyped by direct sequencing on a randomly selected smaller batch of samples.
4
Genomic DNA Isolation and Sequencing
5
Fungal Genomic DNA Isolation and β-Tubulin Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Fungal genomic DNA isolation was carried out by using Wizard Genomic DNA purification kit (Promega, Madison, WI, USA). For genomic DNA isolation, 0.5 g of the mycelial mass was scrapped from the 10-day-old culture and crushed into very fine powder in mortar and pestle using liquid nitrogen. The powder was transferred into micro-centrifuge tube and DNA isolation was further carried out by using Wizard Genomic DNA purification kit (Promega). The β-tubulin gene sequence was amplified using bena-T1 (5' AACATGCGTGAGATTGTAAGT 3'), bena-T22 (5' TCTGGATGTTGTTGGGAATCC 3') primer pair. Amplification was performed in a 25 µL reaction mixture volume consisting of 25 ng of extracted genomic DNA, 0.8 µM of each primer pair, 2.5 mM of dNTPs, 1.5 mM MgCl2, 1.5 U of Taq DNA polymerase. The thermal cycling parameters was 96℃ for 5min followed by 35 cycles of 95℃ for 1 min, 58℃ for 1.30 min, 72℃ for 1.30 min followed by final extension at 72℃ for 7 min [18 (link)19 ]. The amplified product (≈ 800 bp) was purified using Wizard SV gel and PCR clean up system kit (Promega) and the purified products were sequenced at Xcleris Labs (Ahmadabad, Gujarat, India).
6
Yeast DNA Extraction Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For DNA extraction, cells grown on YPD medium were lysed using a FastPrep-24 instrument (MP Biomedicals, Illkirch, France): 100 μL of glass beads (acid-washed, 425–600 μm, Sigma, Lyon, France) were added to cells pellet as well as 300 μl od Nuclei Lysis solution (Wizard Genomic DNA purification Kit, Promega). Cells were crushed through 2 cycles of 20 s (max. speed). Subsequent DNA extraction was performed with the Wizard Genomic DNA purification Kit (Promega) following the manufacturer's protocol.
7
Isolation and DNA Extraction from E. coli Colonies
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After the range expansion experiment on agar, one million cells from the wave front were streaked out on an LB agar plate containing 0.5% arabinose and incubated for 24 hr at 37° to isolate single clones. A single colony was dissolved in 100 μl dilution solution (0.85% NaCl) and 1 µl was transferred to a new LB agar plate containing 0.5% arabinose. The plate was then incubated for 24 hr at 37°. Then, the entire colony was removed from the agar plate and resuspended in 1 ml dilution solution. Genomic DNA was extracted using the Wizard Genomic DNA Purification Kit (Promega, Madison, WI) following the manufacturer’s protocol. The integrity of the DNA was checked by gel electrophoresis. The DNA concentration was determined by fluorometric quantification (Qubit 2.0). After the chemostat experiment, one million cells for each sample were streaked out on an LB agar plate containing 0.5% arabinose and incubated for 24 hr at 37° to isolate single clones. A single colony was transferred to liquid LB medium containing 0.5% arabinose and incubated for 24 hr at 37°. Next, 1 ml of the culture was then used for DNA extraction. Genomic DNA was extracted using the Wizard Genomic DNA Purification Kit (Promega) following the manufacturer’s protocol. The integrity of the DNA was checked by gel electrophoresis. The DNA concentration was determined by fluorometric quantification (Qubit 2.0).
8
Bacterial 16S rRNA Gene Amplification and Phylogeny
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was extracted from five mL bacterial culture grown in Luria broth using Promega wizard genomic DNA purification kit (Promega, Madison, USA) as per the manufacturer’s instruction. The 16S rRNA genes were amplified by PCR using steno1 (5′AGG GAA ACT TAC GCT AAT ACC- 3′) and steno2 (5′CTC TGT CCC TAC CAT TGT AG-3′). The PCR mix contains 0.5 µL, 2.5 U Taq DNA polymerase, 0.5 µL of 10 mM d -NTP mix, 2.5 µL of 10 × PCR buffer, 1 µL (0.5 µM) of each primer, 0.75 µL (50 mM) MgCl2, 16.75 µL double distilled water and 2 µL DNA (10 ng/µL). PCR products were purified and sequenced at the Centro de Biotecnologia Genomica, Instituto Politecnico Nacional (IPN), Mexico using the Thermofisher Applied Biosystems® 3130 Genetic Analyzer. The 16S rRNA gene sequence was analyzed with Seqman software version 13 and subjected to similarity search using the Blastn program from NCBI (https://blast.ncbi.nlm.nih.gov/Blast.cgi ). The sequences were then aligned with homologous sequences retrieved from NCBI database using ClustalW on Mega 6.0 (Tamura et al., 2013 (link)), and a phylogenetic tree was constructed using the neighbor-joining algorithm. Reliability of tree topologies was confirmed by bootstrap analysis using 1,000 repeat alignment. Stenotrophomonas sp. Pemsol 16S rRNA sequence has been deposited on NCBI with ascension number, KX500117.1 .
9
Genomic DNA Extraction from Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A volume of 2 mL of the culture was centrifuged at 16,000 g for 10 min at 4°C in a refrigerated benchtop microcentrifuge. The supernatant was discarded and the cell pellet was resuspended in 600 μL of Nuclei Lysis Solution supplied by Promega Wizard Genomic DNA purification kit (Promega Corporation, Madison, United States). Total DNA extraction was performed using Promega Wizard Genomic DNA purification kit according to manufacturer instructions. DNA quantity and quality were determined using NanoDrop ND-1000 spectrophotometer (NanoDrop Tech, Wilmington, DE, United States), Qubit 2.0 fluorometer (Invitrogen, Life Technologies, CA, United States) and 0.8% agarose gel electrophoresis. Each extraction yielded at least 5 μg of high-quality genomic DNA.
10
Whole Genome Sequencing of Bacterial Strains
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Whole genome sequencing was performed on 74 strains at the University of Toronto in Canada. DNA was extracted and prepared by using the robotic setup described previously [50 (link)]. The genomes were sequenced using an Illumina GAIIx on 250 bp paired-end libraries in 8-fold multiplexes. The remaining 26 strains were sequenced at SSI in Denmark. DNA was extracted and prepared using Promega Wizard Genomic DNA Purification kit (Promega, Madison, USA) and Nextera XT v2 DNA Library Preparation kit (Illumina, San Diego, USA) according to the manufacturer protocol. Whole genome sequencing was performed using an Illumina MiSeq with 250 bp paired-end technology. All genomes were de novo assembled using CLC Genomic Workbench (Qiagen, USA).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!