Poly 1 c

To test the expression pattern of amphioxus DExD/H helicases upon poly(I:C) stimulation, the primary amphioxus intestine cells were transfected with poly(I:C) (Sigma-Aldrich) at a final concentration of 3 μg/ml and collected at 0, 2, 4, 6, 12, and 24 h post-poly(I:C) transfection. Then qRT-PCR assays were conducted using primer pairs:
BbeDHX9-F: 5′GACTACCAGGAATACTTTGAG3′
BbeDHX9-R: 5′CACCACATGATGCTCCACCTT3′
BbeDHX15-F: 5′GGTCGTGGTGTCTACTAACAT3′
BbeDHX15-R: 5′GGTACGTCTGGTCCTGCATCT3′
BbeDDX23-F: 5′CCCAGCAGATCGAGGAGGAGA3′
BbeDDX23-R: 5′CACATCTGGCTCGAAACCCAT3′

Healthy golden pompanos (250 ± 15.2 g) were kept in the running seawater at 26 ± 2°C in our laboratory for at least 2 weeks before experiments. The fishes were randomly divided into four groups (30 fishes per group): LPS challenge group, poly I:C challenge group, Vibrio alginolyticus challenge group and control group, among which the fishes were intraperitoneally (i.p) injected with LPS (100 μg per 100 g fish, Sigma, USA), poly I:C (100 μg per 100 g fish, Sigma, USA), 5×10⁷ CFU live V. alginolyticus (100 μL per 100 g fish, TSTO, China) and same amount of PBS solution, respectively. The head kidney (HK), spleen, liver, intestine and gill were collected from five fishes in each group at 0 h, 6 h, 12 h, 24 h, and 48 h post-injection (hpi). In addition, tissues including spleen, HK, skin, muscle, gill, heart, liver, brain and intestine were respectively collected from five healthy fishes. All tissues were immediately frozen in liquid nitrogen and stored at −80°C until use.

MIS model: On gestational day 15 (GD15), Poly I:C (4 mg/kg, Sigma-Aldrich, Madrid, Spain) or saline solution was administered i.v. to pregnant Wistar rats. This protocol is associated with a high risk of the onset of behavioral and neurological deficits in the offspring at adulthood, similar to those found in patients with SCZ [11 (link),14 (link)]. On post-natal day (PND) 21, male-offspring were weaned and housed 2–4 per cage. Females were not studied because they do not reproduce the well-characterized SCZ-like deficits in males of the MIS model at PND100 [32 (link)].
NAC treatment during gestation: NAC (500 mg/kg, Sigma-Aldrich, Madrid, Spain) diluted in drinking water (VH) was administered at two different time periods during gestation: throughout gestation (NAC21, 21 days of administration) or after the Poly I:C/saline administration (NAC7, 7 days of administration, from gestational days 15 to 21). Water intake was monitored to calculate the dose of NAC ingested by animals and freshly prepared to prevent NAC degradation. The dose of NAC ingested daily by each animal was similar in all groups (minimum dose: 518 mg/kg, maximum dose: 552 mg/kg).
Animals were divided into six groups (6–12 animals per group) according to the factors of the study: phenotype (Saline, MIS) and treatment (water without NAC, water with NAC for 7 days–NAC7, water with NAC for 21 days–NAC21).

At 12.5 dpc, dams were administered an i.p. injection of poly (I:C) (Sigma Aldrich, St. Louis, MO) at 4 mg/kg or 20 mg/kg based on the weight of the poly (I:C) itself [8 (link)]. A model of neurodevelopmental disorder using MIA resulted in severe MIA equivalent to fulminant infection in human [8 (link), 10 (link), 18 (link)–20 (link)]. In clinical settings, all the infected mothers would not suffer from fulminant infection. Therefore, we also examined the effects of comparatively low dose of poly (I:C). In this study, the groups injected with poly (I:C) at 4 mg/kg or 20 mg/kg are presented as Poly 4 and Poly 20, respectively. We injected intraperitoneally mouse recombinant LIF (rLIF; Millipore, Billerica, MA) into dams at 5 μg/kg body weight [14 (link)] at 12.5 or 13.5 dpc. The injection volume was unified into 0.01 ml/g. Control was injected with 0.01 ml/g volume of only saline.

Cells were seeded at 7 × 10³ cells/cm² and treated for 24 hours with increasing doses of recombinant human HMGB-1 (1–200 ng/ml), IL-1α (25–1000 pg/ml), IL-1β (25–1000 pg/ml) (all R&D), LPS (0.1–20 μg/ml) and PolyIC (0.1–20 μg/ml) (both Sigma) or for 24 hours with LPS (5 μg/ml), PolyIC (5 μg/ml), HMGB-1 (50 ng/ml), IL-1α (500 pg/ml) and IL-1β (500 pg/ml) alone or in combination. Cell culture supernatants were harvested for ELISA. For PCR, cells were seeded at 7 × 10³ cells/cm² and treated for 48 hours with TGF-β1 (3 ng/ml).