Protamine sulfate

HT1080 cells and KG-1a cells were genetically modified via spinoculation-mediated transduction using protamine sulfate (Sigma-Aldrich). Therefore, 1 × 10⁵ cells were seeded in a 24-well plate and generated viral vector supernatants were added with 4 µg/ml protamine sulfate (Sigma-Aldrich). For spinoculation, cells were centrifuged for 1 h at 800 ×g and 37°C. NK-92 cells and primary NK cells were transduced in the presence of RetroNectin^® (TaKaRa Bio, Otsu, Shiga, Japan). In brief, 48-well plates were coated with 137 µl of 48 µg/ml RetroNectin^® (TaKaRa) overnight at 4°C. The coated wells were blocked with sterile-filtered phosphate-buffered saline (PBS) (Biochrom) containing 2% BSA (PAN-Biotech) for 30 min at room temperature and washed with HBSS/HEPES (Gibco; PAN- Biotech). Viral vector supernatants were loaded into the wells, and plates were centrifuged for 30 min at 400 ×g and 4°C. After removing supernatants, NK-92 cells (1 × 10⁵) or primary NK cells (2 × 10⁵) were added to each well and incubated for 24 h.
The amount of used viral vector supernatants was calculated regarding the desired multiplicity of infection (MOI) (44 (link)). The transduction efficiency was determined via transgene staining and flow cytometric analysis at least 2 days after transduction.

The pLKO.1 plasmids containing shRNA targeting human PDK1 (shPDK1#261, Clone ID TRCN0000006261; shPDK1#263, Clone ID TRCN0000006263) and PDK2 (shPDK2#314, Clone ID TRCN0000002314; shPDK2#315, Clone ID TRCN0000002315) were acquired from the National RNAi Core Facility (Academia Sinica, Taipei, Taiwan). According to the protocol of the National RNAi Core Facility, pCMVΔR8.91, pMD.G, and pLKO.1 puro plasmids with shRNA lentiviral knockdown vectors were transfected using TransIT-LT1 reagent (Mirus Bio) and packaged in HEK293T cells. HNC cells were then infected with shLuc or shPDK1 or shPDK2 lentivirus in the presence of 8 μg/ml of protamine sulfate (Merck Millipore, Billerica, MA, USA). Stable clones were selected by puromycin (2 μg/mL, Sigma-Aldrich, St Louis, MO, USA) for 14 days.

CRISPR-Cas9 based gene editing was used to create FAME KO lines in A549 cells. Single Guide RNAs (sgRNAs) were designed using CRISPOR^{86 (link)} and cloned into lentiCRISPR v2 (Addgene #52961) flowing the Zheng lab protocol^{87 (link)} (sgRNA: AAGTCCACACGGCCAGCCGA). Plasmids were validated by sequencing. Lentiviral particles were produced in HEK293T cells by co-transfection of 2.4 µg of psPAX2 (Addgene #12260), 1.8 µg MD2.G (Addgene #12259) and 3.6 µg lentiCRISPR v2-sgRNA construct using polyethyleneimine (PEI, 25 K, Polysciences) at a 1:3 DNA:PEI (1 µg/µl) ratio. Supernatants were harvested 48 h post-infection. For knocking out FAME, 1 × 10⁵ cells were seeded into 6-well plates, virus-particle containing supernatant was added, and protamine sulfate (Merck) at 8 µg/mL was added. Cells were transduced by spinfection at 800 x g for 60 min. Selection of infected cells was started 24 h post-transduction using 2 µg/mL puromycin (Cayman Chemical). Single-cell clones were obtained by limiting dilution. Genomic DNA was extracted using the Monarch gDNA Purification Kit (New England Biolabs) according to manufacturer instructions. FAME KO was validated by sequencing of the FAME locus with the sequencing primers (Microsynth): sgRNA KO locus, fwd 5’ GCCATGAAGGAAATGACTGCT 3’, rvs 5’ TCAAAACCACAAAGTCTGGTGC 3’. The validation of these knockouts can be found in Supplementary Fig. 22.

To generate receiver cells, HEK293 cells which express the puromycin-resistant mediating PAC transgene for later selection in the experimental setup were used. In a first step, the tTA or Gal4 binding motif 5′ of the CMV_min promoter (Response Element; RE) was transduced into HEK293 cells (German Collection of Microorganisms and Cell Cultures GmbH (DSMZ), Braunschweig, Germany). Cells were seeded with a density of 25,000 cells/cm² in a 6-well culture dish (TPP, Switzerland), and 2 mL of viral supernatant containing 10 µM protamine sulfate (Merck, Darmstadt, Germany) was added to the cells. The medium was changed after 24 h and cultured for another 72 h. These HEK293 cells were passaged and reseeded with a density of 25,000 cells/cm² and transduced a second time with either the LaG17_synNotch_TetRVP64 (tTA RE), the antiCD19_synNotch_Gal4VP64, antiHer24D5-3_synNotch_Gal4VP64, or antiHer24D5-5_synNotch_Gal4VP64 (all Gal4 RE) viral supernatant (2 mL) containing 10 µM protamine sulfate. This double transduced, heterogeneous cell population was cultured for an additional 72 h and was then activated with their corresponding antigen (see below) and sorted by flow cytometry (see below). Of note, the maintenance culture was frequently analyzed for unspecific or spontaneously dsRed-Express expression.