Total RNAs of three CRC cells and NCM460 cells were isolated using TRIzol reagent respectively (Takara, Tokyo, Japan) according to the manufacturer’s instructions. For miR-193a-3p, reverse transcription reactions were performed with an All-in-One™ miRNA qRT-PCR Detection Kit (GeneCopoeia, MD, USA) to obtain the complementary DNA (cDNA) templates. The qPCR was performed in an iQ5 Real-Time PCR Detection Systems (Bio-Rad, CA, USA) using All-in-One™ miRNA qRT-PCR Detection Kit (GeneCopoeia, MD, USA). The relative expression levels of miR-193a-3p were normalized to the expression level of human actin beta (hACTB). The PCR primes for miR-193a-3p and hACTB are as follows: miR-193a-3p: forward: 5ʹ-AACTGGCCTACAAAGTCCCAGT-3, and the reverse primer was provided in the All-in-One™ miRNA qRT-PCR Detection Kit. hACTB: forward: 5′GGCACTCTTCCAGCCTTCC-3′, reverse:5′-GAGCCGCCGATCCACAC-3′. The data analyses were performed using the 2−ΔΔCt method.
All in one mirna qrt pcr detection kit
Manufactured by GeneCopoeia
Sourced in United States, China, Japan
The All-in-One™ miRNA qRT-PCR Detection Kit is a product designed for the detection and quantification of microRNA (miRNA) expression levels using real-time quantitative reverse transcription PCR (qRT-PCR) technology. The kit provides a complete set of reagents and protocols for the entire workflow, including RNA extraction, reverse transcription, and real-time PCR amplification.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (112 mentions)
Primescript rt reagent kit, by Takara Bio (34 mentions)
Trizol, by Thermo Fisher Scientific (29 mentions)
Sybr premix ex taq, by Takara Bio (21 mentions)
All in one mirna first strand cdna synthesis kit, by GeneCopoeia (15 mentions)
Ne per nuclear and cytoplasmic extraction reagent, by Thermo Fisher Scientific (12 mentions)
Quantitect sybr green pcr kit, by Qiagen (10 mentions)
Sybr green master mix, by Bio-Rad (9 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (8 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (8 mentions)
Rnazol, by Merck Group (7 mentions)
Sybr premix ex taq 2, by Takara Bio (7 mentions)
Sybr green realtime pcr master mix, by Toyobo (7 mentions)
Quantitect reverse transcription kit, by Qiagen (6 mentions)
All in one qpcr mix, by GeneCopoeia (6 mentions)
Gotaq qpcr master mix, by Promega (5 mentions)
All in one first strand cdna synthesis kit, by GeneCopoeia (5 mentions)
7500 real time pcr system, by Thermo Fisher Scientific (5 mentions)
Abi 7500 thermocycler, by Thermo Fisher Scientific (5 mentions)
Lightcycler 480, by Roche (5 mentions)
267 protocols using all in one mirna qrt pcr detection kit
1
Quantifying miR-193a-3p Expression in CRC Cells
2
RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from MEFs, NIH/3T3, or mouse tissues using TRIzol reagent (Life Technologies, USA) according to the manufacturer's protocol. The quality and quantity of the extracted RNAs were determined from OD260/280 nm reading by DS‐11 spectrophotometer (DeNovix, USA).
For miRNA, 1 μg total RNA was reverse transcribed using All‐in‐One miRNA qRT‐PCR Detection Kit (GeneCopoeia, USA) according to the manufacturer's recommendations. qRT‐PCR was then carried out in a LightCycler 96 (Roche, Switzerland) with All‐in‐One miRNA qRT‐PCR Detection Kit (GeneCopoeia, USA). Primers specific for miR‐124, miR‐34a, miR‐29a/b/c, miR‐214, miR‐194, miR‐199a, miR‐142, miR‐223, and U44 were all purchased from GeneCopoeia. U68 was included as internal control.
For mRNA, 1 μg total RNA was reverse transcribed using PrimeScript RT Reagent Kit with gDNA Eraser (Takara, Japan) according to the manufacturer's recommendations. qRT‐PCR was performed in a LightCycler 96 (Roche, Switzerland) with SYBR Select Master Mix (Life Technologies, USA). The primers used for Ccna2, Cdk1, E2f7, Ccnb1, Bub1, Bub1b, Aukra, Timp1, Vcam1, Dll1, Mmp9, and β‐Actin are listed in Supporting Information TableS4 . β‐Actin gene was used as internal control.
For miRNA, 1 μg total RNA was reverse transcribed using All‐in‐One miRNA qRT‐PCR Detection Kit (GeneCopoeia, USA) according to the manufacturer's recommendations. qRT‐PCR was then carried out in a LightCycler 96 (Roche, Switzerland) with All‐in‐One miRNA qRT‐PCR Detection Kit (GeneCopoeia, USA). Primers specific for miR‐124, miR‐34a, miR‐29a/b/c, miR‐214, miR‐194, miR‐199a, miR‐142, miR‐223, and U44 were all purchased from GeneCopoeia. U68 was included as internal control.
For mRNA, 1 μg total RNA was reverse transcribed using PrimeScript RT Reagent Kit with gDNA Eraser (Takara, Japan) according to the manufacturer's recommendations. qRT‐PCR was performed in a LightCycler 96 (Roche, Switzerland) with SYBR Select Master Mix (Life Technologies, USA). The primers used for Ccna2, Cdk1, E2f7, Ccnb1, Bub1, Bub1b, Aukra, Timp1, Vcam1, Dll1, Mmp9, and β‐Actin are listed in Supporting Information Table
3
Quantitative Analysis of miRNA and mRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from the samples using RNAiso Plus (9109, Takara). The expression levels of miRNA were analysed using an All-in-One™ miRNA qRT-PCR Detection Kit (QP015, GeneCopoeia). For mRNA expression analysis, total RNA was transcribed to complementary DNA using PrimeScript RT reagent Kit with gDNA Eraser (RR047A, Takara) following the manufacturer’s instructions. Expression of selected genes was analysed using TransStart® Top Green qPCR SuperMix (AQ132, TransGen Biotech). Quantitative real-time polymerase chain reaction (qPCR) was performed on the ABI-7900HT system (Applied Biosystems). The relative expression of target genes was measured using the 2−ΔΔCt method, and the amount of target gene was normalized to the endogenous control gene U6 or β-actin. Sequences of primers are shown in Table S1.
4
Quantifying Gene and miRNA Expression in SHP-77 Cells and Tissue Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To measure gene expression levels, SHP-77 cells (105 cells harvested at 24 h post-transfection) and tissue samples (0.03 g tissue ground in liquid nitrogen) were subjected to total RNA extractions using Ribozol (Sigma-Aldrich). To harvest miRNAs, 85% of ethanol was used to precipitate RNA samples. All RNA samples were treated with DNase I for 2 h at 37 °C to digest genomic DNAs.
To measure the levels of LUADT1 and Twist1 mRNA expression, the MMLV Reverse Transcriptase kit (Lucigen) was used to perform all reverse transcriptions and SYBR Green Master Mix (Bio-Rad) was used to prepare qPCR assays with GAPDH as an endogenous control.
To measure the levels of mature miR-15a-3p expression, poly (A) addition, reverse transcriptions and all qPCR assays were performed using All-in-One™ miRNA qRT-PCR Detection Kit (Genecopoeia). The endogenous control was U6.
Three replicate reactions were set for each experiment and Ct values were processed using the 2-ΔΔCT method.
To measure the levels of LUADT1 and Twist1 mRNA expression, the MMLV Reverse Transcriptase kit (Lucigen) was used to perform all reverse transcriptions and SYBR Green Master Mix (Bio-Rad) was used to prepare qPCR assays with GAPDH as an endogenous control.
To measure the levels of mature miR-15a-3p expression, poly (A) addition, reverse transcriptions and all qPCR assays were performed using All-in-One™ miRNA qRT-PCR Detection Kit (Genecopoeia). The endogenous control was U6.
Three replicate reactions were set for each experiment and Ct values were processed using the 2-ΔΔCT method.
5
RNA Extraction and miRNA Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from cells and tissues using TRIzol (RNAiso, Takara) and purified by the chloroform-phenol extraction method. cDNA was reverse transcribed with the SureScript First-stand cDNA Synthesis Kit (GeneCopoeia) and then detected by the All-in-One™ miRNA qRT-PCR Detection Kit (GeneCopoeia). Real-time quantitative PCR (RT-qPCR) was performed on a Bio-Rad CFX-96 Touch Real-Time Detection systems, all data were normalized to GAPDH. Primer sequences are listed in Table S1 .
6
Isolation and Quantification of RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated by TRIzol (Invitrogen). Nuclear and cytoplasmic fractions were isolated by NE-PER Nuclear and Cytoplasmic Extraction Reagents (Thermo Scientific, USA). qRT-PCR was performed with SYBR Premix Ex Taq (Takara Bio Inc., China) and All-in-One™miRNA qRT-PCR Detection Kit (GeneCopoeia, USA). Primers were synthesized by Invitrogen (Supplementary Table 1 ).
7
Quantitative Analysis of Gene and miRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from patient tissues and cultured cells using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) as per the manufacturer’s instructions. Total RNA (1 μg) was reverse transcribed to high-quality cDNA with the Moloney Leukemia Virus Reverse Transcriptase Kit (Promega, Madison, WI, USA). qRT-PCR was performed using the SYBR Green Mix (Promega) to detect expression of the long noncoding and coding genes; the results were normalized to GAPDH expression. The expression of the miRNAs in this study was measured using the All-in-One™ miRNA qRT-PCR Detection Kit (GeneCopoeia, Carlsbad, CA, USA), and qRT-PCR was performed on the ABI 7500 Fast Real-Time PCR System (Applied Biosystems, Waltham, MA, UK). Small RNA RNU6B (U48) was used as the endogenous control to normalize miRNA expression. Each sample was run in triplicate, and fold changes were calculated using the relative quantification 2-△△CT method. The primer sequences used in this study are shown in Additional file 1 : Table S1.
8
Quantitative miR-9-5p Expression Profiling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNAs of human tissues and cells were extracted using TRIzol reagent (Invitrogen). Quantitative real-time PCR technology was used to measure the miR-9-5p expression by using the All in-One miRNA qRT-PCR Detection Kit (GeneCopoeia, Rockville,MD, USA). hsa-miR-9-5p forward primer: 5′TGCGCTCTTTGGTTATCTAGCTG3′; reverse primer: 5′CCAGTGCAGGGTCCGAGGTATT3′; U6 forward primer: 5′CGCTTCGGCAGCACATATAC 3′; reverse primer: 5′AAATATGGAACGCTTCACGA3′. All qRT-PCR processes and analyses were carried out using Applied Biosystems 7500 Fast Real-Time PCR system (Life Technologies). Relative expression of miRNA and mRNA was calculated using the 2−ΔΔCT method.
9
Reverse Transcription and qRT-PCR for ncRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The Goscript Reverse Transcription System (Promega, Madison, WI, USA) was used to reverse transcribe lncRNAs, circRNAs, and mRNAs to cDNA. Go Taq qPCR Master Mix (Promega) was used for qRT-PCR. All-in-one miRNA qRT-PCR Detection kit (Genecopoeia, Rockville, MD, USA) was used to reverse transcribe and amplify miRNAs. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as an internal control for the relative quantitation of lncRNAs, circRNAs, and mRNAs, whereas U6 was used for miRNAs. The detection of internal control gene GAPDH would be affected after treating with RNase R; we divided the same RNA sample into two uniform parts when performing the qRT-PCR experiment. One part was treated with RNase R for delinearization; this part was for the further detection of circRNA. The other part was treated with RNase R-free water for finally detecting GAPDH gene. The primer sequences are shown in Supplementary Table 3. The 2−ΔΔCt method was used to determine relative expression levels.
10
Quantitative Analysis of mRNA and miRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For mRNA, total RNA was extracted and 500 ng of RNA was used for cDNA synthesis using the Takara reverse transcription kit (Takara, Dalian, China) according to the manufacturer’s instructions. PCR was conducted using SYBR Premix Ex Taq (Takara, Dalian, China) according to the manufacturer’s instructions on an Mx3000P system (Agilent Stratagene, Santa Clara, CA, USA). The primers were chemically synthesized by Tsingke, Wuhan, China and are listed in Table S1 . The All-in-One™ miRNA qRT-PCR Detection Kit (GeneCopoeia, Guangzhou, China) was used for both cDNA synthesis and quantitative detection using miRNA specific primers (GeneCopoeia, Guangzhou, China). GAPDH and U6 were used as internal controls to determine the relative expression of target mRNA and miRNA. All reactions were performed in triplicate.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!