Superscript one step rt pcr kit

Manufactured by Thermo Fisher Scientific

Sourced in United States

The SuperScript One-Step RT-PCR kit is a reagent system designed for reverse transcription and subsequent polymerase chain reaction (RT-PCR) in a single-tube format. The kit contains the necessary components for both reverse transcription of RNA and amplification of the resulting cDNA.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

SuperScript One-Step RT-PCR Step One PCR RT-PCR kit RT kits

59 protocols using superscript one step rt pcr kit

Quantitative Gene Expression Analysis

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from tissues and cells using TRIzol (Invitrogen, Thermo Fisher Scientific, Inc.). Then RNA (1 μg) was converted into cDNA using a SuperScript^® One-Step RT-PCR kit (Thermo Fisher Scientific, Inc.), and qPCR was performed to examine the mRNA expression using a SuperScript^® One-Step RT-PCR kit (Thermo Fisher Scientific, Inc.), according to the manufacturer’s protocol. The PCR reaction conditions were as follows: 95°C for 3 min, followed by 40 cycles at 95°C for 15 s and 60°C for 30 s. The relative expression levels were analyzed using the 2^−ΔΔCq method21 (link).

Tan X., Liao Z., Zou S., Ma L, & Wang A. (2020). VASH2 Promotes Cell Proliferation and Resistance to Doxorubicin in Non-Small Cell Lung Cancer via AKT Signaling. Oncology Research, 28(1), 3-11.

+ Open protocol

+ Expand

MERS-CoV Detection via RT-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Mono- (MERS-CoV specific primers only) or multiplexed one-step RT-PCR reactions (combination of MERS-CoV and RSV, SARS-CoV, InfA, InfB primers, (Table 1) including MERS-CoV RNA (100 copies) were carried out by SuperScript One-Step RT-PCR kit with Platinum Taq (Life Technologies, Carlsbad, CA). Reactions took place in 1 x reaction mix with additional MgSO₄ (1.5 mM, final volume, 20 μL). The reaction mixture contained 0.3 μM of each sets of forward and reverse hybrid SAMRS-AEGIS target-specific primers, and 2.5 U of RT/Platinum Taq enzyme mix. RT-PCR cycling conditions were as follows: 1 cycle of the complementary DNA (cDNA) synthesis and pre-denaturation (55 °C for 30 min and 94 °C for 2 min), 35 cycles of PCR (94 °C for 15 s, 56 °C for 30 s, and 70 °C for 30 s), and final extension at 72 °C (5 min).

Yaren O., Glushakova L.G., Bradley K.M., Hoshika S, & Benner S.A. (2016). Standard and AEGIS nicking molecular beacons detect amplicons from the Middle East respiratory syndrome coronavirus. Journal of Virological Methods, 236, 54-61.

+ Open protocol

+ Expand

MERS-CoV Detection via Multiplex RT-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Mono- (MERS-CoV specific primers only) or multiplexed one-step RT-PCR reactions (combination of MERS-CoV and RSV, SARS-CoV, InfA, InfB primers, (Table 1) including MERS-CoV RNA (100 copies) were carried out by SuperScript One-Step RT-PCR kit with Platinum Taq (Life Technologies, Carlsbad, CA). Reactions took place in 1 × reaction mix with additional MgSO₄ (1.5 mM, final volume, 20 μL). The reaction mixture contained 0.3 μM of each sets of forward and reverse hybrid SAMRS-AEGIS target-specific primers, and 2.5 U of RT/Platinum Taq enzyme mix. RT-PCR cycling conditions were as follows: 1 cycle of the complementary DNA (cDNA) synthesis and pre-denaturation (55 °C for 30 min and 94 °C for 2 min), 35 cycles of PCR (94 °C for 15 s, 56 °C for 30 s, and 70 °C for 30 s), and final extension at 72 °C (5 min).

+ Open protocol

+ Expand

T Cell Activation and qRT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

T cells were activated with 20 ng/ml PMA and 1 mM ionomycin in RPMI 1640 (GIBCO-Thermo Fisher Scientific) supplemented with 10% FBS, 1% L-glutamine and 1% penicillin/streptomycin (complete medium) for 3 h at 37°C under 5% CO₂ and total cellular RNA was purified using PureLink^™ RNA kit (Life Technology) or RNeasy Mini Kit (Qiagen) and the concentration and RNA Integrity Number (RIN) was determined with a RNA 6000 nano kit on 2100 Bioanalyzer instrument (Agilent Technologies). Real-time PCR was performed on samples in duplicate on an ABI 7900HT Real-Time PCR System (Applied Biosystems) or Eco Real-Time PCR System (Illumina) using SuperScript One Step RT-PCR kit (Life Technology). For most experiments, primer and probe sets (FAM/MGB-labeled) were purchased from Applied Biosystems. In some cases, DELTAgene Assay primers were purchased from Fluidigm and amplicon DNA was quantified using SsoFast^™ EvaGreen Supermix with Low ROX (Bio-Rad Laboratories). Gene expression data were normalized based on the values for GAPDH mRNA. For some assays, for cells from each donor, relative levels of expression, based on values for 2^−ΔCT, are shown after normalization to the single highest value, which was set to 100. For other assays, values of 2^−ΔCT or ΔCT are shown without additional normalization or shown as fold changes relative to the values for naïve cells, which were set at 1.

Singh S.P., Parween F., Edara N., Zhang H.H., Chen J., Otaizo-Carrasquero F., Cheng D., Oppenheim N.A., Ransier A., Zhu W., Shamsaddini A., Gardina P.J., Darko S.W., Singh T.P., Douek D.C., Myers T.G, & Farber J.M. (2023). Human CCR6+ Th cells show both an extended stable gradient of Th17 activity and imprinted plasticity. Journal of immunology (Baltimore, Md. : 1950), 210(11), 1700-1716.

+ Open protocol

+ Expand

Gene Expression Analysis by RT-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were activated with 20 ng/ml PMA and 1 mM ionomycin for 4 h and total cellular RNA was purified using PureLink™ RNA kit (Life Technology). Reverse transcription and real-time PCR was performed in duplicate (10-50 ng RNA per sample) using SuperScript One Step RT-PCR kit (Life Technology). Primer and probe sets (FAM/MGB-labeled) were purchased from Applied Biosystems. Results were normalized based on the values for GAPDH mRNA, detected using TaqMan GAPDH Control reagents (Applied Biosystems).

Singh S.P., Zhang H.H., Tsang H., Gardina P.J., Myers T.G., Nagarajan V., Lee C.H, & Farber J.M. (2015). PLZF Regulates CCR6 and is Critical for the Acquisition and Maintenance of the Th17 Phenotype in Human Cells. Journal of immunology (Baltimore, Md. : 1950), 194(9), 4350-4361.

+ Open protocol

+ Expand

T Cell Activation and Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

T cells were activated with 20 ng/ml PMA and 1 mM ionomycin in RPMI 1640 (GIBCO-Thermo Fisher Scientific) supplemented with 10% FBS, 1% L-glutamine and 1% penicillin/streptomycin (complete medium) for 3 h at 37°C under 5% CO 2 and total cellular RNA was purified using PureLink ™ RNA kit (Life Technology) or RNeasy Mini Kit (Qiagen) and the concentration and RNA Integrity Number (RIN) was determined with a RNA 6000 nano kit on 2100 Bioanalyzer instrument (Agilent Technologies). Real-time PCR was performed on samples in duplicate on an ABI 7900HT Real-Time PCR System (Applied Biosystems) or Eco Real-Time PCR System (Illumina) using SuperScript One Step RT-PCR kit (Life Technology). For most experiments, primer and probe sets (FAM/MGB-labeled) were purchased from Applied Biosystems. In some cases, DELTAgene Assay primers were purchased from Fluidigm and amplicon DNA was quantified using SsoFast ™ EvaGreen Supermix with Low ROX (Bio-Rad Laboratories). Gene expression data were normalized based on the values for GAPDH mRNA. For some assays, for cells from each donor, relative levels of expression, based on values for 2 -ΔCT , are shown after normalization to the single highest value, which was set to 100. For other assays, values of 2 -ΔCT or ΔCT are shown without additional normalization or shown as fold changes relative to the values for naïve cells, which were set at 1.

Singh S.P., Parween F., Edara N., Zhang H.H., Chen J., Otaizo-Carrasquero F., Cheng D., Oppenheim N.A., Ransier A., Zhu W., Shamsaddini A., Gardina P.J., Darko S.W., Singh T.P., Douek D.C., Myers T.G, & Farber J.M. (2023). Human CCR6+ Th Cells Show Both an Extended Stable Gradient of Th17 Activity and Imprinted Plasticity. Journal of immunology (Baltimore, Md. : 1950), 210(11).

+ Open protocol

+ Expand

Quantifying Gene Expression: RNA Extraction, RT-qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Extraction of total RNA was from tissues and cell lines adopting TRIzol reagent (Thermo Fisher Scientific, Inc.) in light of the manufacturer’s instructions. A total of 1 μg RNA was transformed into a complementary DNA adopting the SuperScript one-step RT-PCR kit (Thermo Fisher Scientific, Inc.) in light of the manufacturer’s instructions. RT-qPCR was implemented in ABI 7500 FLUORESCENCE qPCR machine (Applied Biosystems; Thermo Fisher Scientific, Inc.) adopting the Applied Biosystems™ PowerUp™ SYBR Green Master Mix kit (Thermo Fisher Scientific, Inc.). U6 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were loading controls. Calculation of each gene’s relative quantitative values was by 2^−ΔΔCt method. Primer sequences (GenePharma Co., Ltd., Shanghai, China) are presented in Table 1.

Table 1.

Primers for RT-qPCR

Genes	Primer sequences (5’–3’)
Circ-ZFR	F: TCCCAATGCTAAGGAGATGC
Circ-ZFR	R: TTCTTCTCGTCTTCGCCAGT
MiR-212-5p	F: ACCTTGGCTCTAGACTGCT
MiR-212-5p	R: GCAGGGTCCGAGGTATTC
SOD2	F: GCCTCCCTGACCTGCCTTAC
SOD2	R: GTGATTGATATGGCCCCCG
U6	F: CTCGCTTCGGCAGCACA
U6	R: AACGCTTCACGAATTTGCGT
GAPDH	F: CGGAGTCAACGGATTTGGTCGTAT
GAPDH	R: AGCCTTCTCCATGGTGGTGAAGAC

Qu D., Zou X, & Liu Z. (2022). Propofol modulates glycolysis reprogramming of ovarian tumor via restraining circular RNA-zinc finger RNA-binding protein/microRNA-212-5p/superoxide dismutase 2 axis. Bioengineered, 13(5), 11881-11892.

+ Open protocol

+ Expand

Connexin Gene Expression in Zebrafish

Check if the same lab product or an alternative is used in the 5 most similar protocols

Expression of connexin genes in adult zebrafish tissues or whole 1-5 days post-fertilization (dpf) fry was assessed by rtPCR. Animals were sacrificed by chilling in tank water on ice. Total RNA was purified from dissected tissues or whole fry using Tri-reagent (Sigma, St. Louis, MO) using the manufacturer's protocol. Reverse transcription and PCR were performed in a single tube using SuperScript One-step RT-PCR kit (ThermoFisher, Waltham, MA) and 0.5 μg of total RNA template. Primers used include for cx34.1: cx34.1RT-F1 5’-TTGCTGGAGGCTGCGGTACAGCAGC-3’, cx34.1RT-R1 5’-CAACCTCCTTCACGCAAGGGTAGCG-3’; for cx44.1: cx44.1RT-F1 5’-CATTCGGGCGACAAGGATTGGAGGC-3’, cx44.1RT-R1 5’-CTGCCCTTTGTGCTCGTCTCCTTGG-3’; for cx48.5: JS7-Cx48.5CT-F 5’-GCGCCTCCAACCCTCAGCTA-3’, JS8-Cx48.5CT-R 5’-GGGGGAGGTGGCGTTCATCT-3’; for cx79.8: cx50.5RT-F1 5’-CAGGAGTTCAATTCGCCCCACAGGG-3’, cx50.5-ex2-R1 5’-CCTCCATGTGGATGTAATGGACAGC-3’, cx50.5-ex2-R2 5’-GCTTTGTGTTCCACCGACCAGCTCC-3’; for actb1: Zbactin1-ex4F 5’-GTCCGTGACATCAAGGAGAAGC-3’, Zbactin1-ex6R 5’-GGATGGGCCAGACTCATCGTAC-3’.

Yoshikawa S., Vila A., Segelken J., Lin Y.P., Mitchell C.K., Nguyen D, & O'Brien J. (2016). Zebrafish Connexin 79.8 (Gja8a): a lens connexin used as an electrical synapse in some neurons. Developmental neurobiology, 77(5), 548-561.

+ Open protocol

+ Expand

Quantitative RT-PCR Analysis of Myc Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted with the RNeasy Plus Mini Kit (Qiagen 74,134) from MM cell lines. One-microgram of RNA was reverse-transcribed by SuperScript one-step RT-PCR Kit (ThermoFisher 10,928–034) according to the manufacturer’s instructions. Using Taqman Gene Expression Assay probe/primer [Hs00153408 for Myc], cDNAs were amplified in a fluorescence thermocycler (ABI StepOnePlus Real-time PCR System, Applied Biosystems, CA, USA) and were analyzed based on the expression level of GADPH with SDS2.2 software (Applied Biosystems).

Li L., Hu X., Nkwocha J., Sharma K., Kmieciak M., Mann H., Zhou L, & Grant S. (2023). Non-canonical role for the ataxia-telangiectasia-Rad3 pathway in STAT3 activation in human multiple myeloma cells. Cellular Oncology (Dordrecht), 46(5), 1369-1380.

+ Open protocol

+ Expand

Self-Pollination and RNA Isolation

Check if the same lab product or an alternative is used in the 5 most similar protocols

Twenty-five flowers from wild-type (WT) and DRH-195/310-derived T₀ KO lines (DRH-195.158 and DRH-310.21) were self-pollinated at anthesis. Pollinated pistils were excised 24-hour post pollination (hpp) and preserved in -80°C until use. Total RNA was isolated using the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany) and DNase treated using the TURBO DNA-free kit (Thermo Fisher, Carlsbad, CA, United States) following manufacturer’s instructions. RNA was quantified using a NanoDrop spectrophotometer (Thermo Fisher Scientific, Grand Island, NY, United States) and a reverse-transcription polymerase chain reaction (RT-PCR) was carried-out with 1 μg of total RNA using the Super-Script One-Step RT-PCR kit (Thermo Fisher Scientific, Carlsbad, CA, United States). Primers designed to amplify the S-RNase ORF and the elongation-factor one alpha (EF1α) housekeeping internal control were used for the RT-PCR reaction (Supplementary Table S2).

Enciso-Rodriguez F., Manrique-Carpintero N.C., Nadakuduti S.S., Buell C.R., Zarka D, & Douches D. (2019). Overcoming Self-Incompatibility in Diploid Potato Using CRISPR-Cas9. Frontiers in Plant Science, 10, 376.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!