Powerfecal kit

Fecal samples collected from participants were stored at 4 °C until delivered to the laboratory within a 36-h period. Anaerocult was used in order to preserve anaerobic species present within a sample. The samples were homogenized, aliquoted, and stored at − 80 °C until used for microbial DNA extraction. DNA extraction was performed using the Qiagen Powersoil kit with the addition of the heating step from the Powerfecal kit (heating at 65 °C for 10 min). Resulting microbial DNA was subjected to PCR in order to amplify the V4 region of the 16S rRNA gene. The resulting library fragments were normalized using the SequalPrep normalization plates (Invitrogen, Carlsbad, CA). The libraries were pooled and analyzed via an Agilent Bioanalyzer trace. Samples were split into two sequencing runs in order to increase sample read depth. Samples were grouped together by family groups (twins, spouses) in order to make sure all samples from a family were sequenced in the same sequencing run. Sequencing data was generated on the MiSeq platform, using a 2 × 251 paired-end sequencing run with 20% Phix to increase base diversity during the run.

Species identification was carried out using 100ml of bacterial culture grown in LB rich medium. After 24H, the culture was centrifuged at 5000 g for 5 min at 4°C, and the corresponding pellet, which consisted of bacteria, was isolated. Thereafter, bacteria DNA was extracted and purified using Qiagen Powerfecal Kit (Hilden, Germany), following the user’s manual. The resulting purified DNA was subjected 16S rRNA gene amplification by PCR and sequencing, as described previously [28 (link)]. Around 1400 base pairs of 16S rRNA gene was amplified using Primers 27F AGAGTTTGATCMTGGCTCAG and 1492R CGGTTACCTTGTTACGACTT, and then sequenced using the primers 518F: CCAGCAGCCGCGGTAATACG and 518R: GTATTACCGCGGCTGCTGG, a Big Dye terminator cycle sequencing kit (Applied BioSystems, USA), and an automated DNA sequencer (Applied BioSystems model 3730XL, USA). The use of Basic Local Alignment Search Tool (BLAST), available at the National Center for Biotechnology Information (NCBI) database, permitted species identification.

Morning fecal pellets were collected from co-housed WT and Secret1 adult animals aged 10–12 weeks. Fecal pellets were immediately frozen in liquid nitrogen and stored until use. DNA was extracted using QIAGEN power fecal kit according to manufacturer’s instructions. DNA purity and concentration were measured on a nanodrop device. Paired-end 16 s sequencing was carried out by a commercial vendor (SeqMatic) using an Illumina MiSeq platform. Sequencing data were then subjected to standard QIIME2 pipeline workflow (Bokulich et al., 2018 (link); Caporaso et al., 2010 (link)), consisting of pre-processing quality preparation (trimming, demultiplexing, DADA2 quality filtering), phylogenetic profiling, alpha and beta diversity analysis, sequence alignment, taxonomic assignment and distribution analysis; and differential abundance testing using ANCOM.