Biotin

A 50-bp LrCHI2 promoter fragment with one W-box was used as the probe. The mutant probe had one mutation in the W-box core sequence (Supplementary Table 1). These two probe sequences were synthesized and labeled with biotin (Sangon Biotech, China). The unlabeled probe served as the competitor. The EMSA reaction mixtures contained 0.5 μg purified LrWRKY2 protein and 7 μL 1 × gel shift binding buffer [100 mM Tris, 500 mM KCl, 10 mM DTT, 50% glycerol, 100 mM MgCl₂, 1% NP-40, 1 M KCl, 200 mM EDTA, and 1 μg/μL poly (dI•dC)] in a total volume of 20 μL. After a 20-min incubation at room temperature, 2 μL biotin-labeled probes were added and the incubation was continued for 20 min. For the competitor probe, the binding reaction components were incubated for 40 min. The DNA–protein complexes were electrophoresed on 6.5% non-denaturing polyacrylamide gels in an ice-cold water bath and then transferred to a nylon membrane. Finally, the membrane was dried and analyzed using the LightShift Chemiluminescent EMSA Kit (Pierce, USA).

The fusion construct GST-ZmNLP3.1 or the plasmid expressing GST alone was transformed into Escherichia coli BL21 (DE3) cells. The GST-ZmNLP3.1 and GST proteins were purified with glutathione beads (Xu et al., 2013 (link)), according to the manufacturer's protocol. Briefly, 5'-biotinylated probes were synthesized and labeled with biotin by Sangon Biotechnology. Double-stranded probe (50 fmol) was mixed with each purified protein separately in binding buffer and incubated for 10 min. The reaction mixtures were subjected to electrophoresis on a native 6% polyacrylamide gel in 0.5× TBE buffer. DNA in the gel was transferred to a positive charged nylon membrane and detected using the EMSA kit (Beyotime Company), according to the manufacturer's instructions (Ahmad et al., 2019 (link)).

Sequences corresponding to amino acids 220–392 of ARX^WT/mut were amplified from pEGFP-C1-Arx^WT/mut as described above and then cloned into the vector of pGEX-4T-2 (GE Healthcare Life Sciences). GST-ARX (220–392)^WT/mut protein was expressed in Escherichia coli BL21 competent cells (Invitrogen), and its expression was induced by the addition of 0.2 mM IPTG to late logarithmic cultures (OD = 0.6) for 4 h at 25°C. Cells were then harvested, resuspended in bacteria lysis buffer (50 mM Tris/HCl [pH 8.0], 200 mM NaCl, 200 mM EDTA, 10% Glycerol, 1 mM DTT, 1 mM PMSF, 1 mg/ml lysozyme) and disrupted by sonication. After centrifugation, the supernatants were applied to Glutathione Sepharose 4B beads (GE Healthcare Life Sciences), and the beads were washed with PBS. The GST fusion protein was finally eluted with 30 mM reduced glutathione in 50 mM Tris-Cl, pH 8.0.
Electrophoretic mobility shift assays (EMSAs) were performed as previously described with slight modifications [24 (link)]. The purified ARX protein truncation was applied to 6% polyacrylamide gel with double-stranded oligonucleotides, SIX1, F (5′-TCTTAACATTAAGGTAATTAAATATGAGCTCAC-3′)/SIX1, R (5′-GTGAGCTCATATTTAATTACCTTAATGTTAAGA-3′) labeled by biotin (Sangon Biotech). To detect the DNA/ARX complex, we utilized the LightShift® Chemiluminescent EMSA kit (Thermo Scientific).

Yeast one-hybrid assays were conducted using a Matchmaker^TM Gold Yeast One-Hybrid Library Screening System (Clontech, Mountain View, CA, USA). The sequence including the underlined MBS element (TACCCTCTCATGTCCCTGTGAACCTAACGTAAGGCATTACGATTTGTAT) from the promoter of VvACS1 was synthesized and inserted into a pHis2 vector. The ORF of VvMYB14 was subsequently amplified and inserted into a pGADT7 vector. The resultant plasmid was introduced into the yeast strain Y1HGold. The detailed procedure was performed according to the user manual for this system, and 3-AT was used as a screening marker^{54 (link)}.
For the EMSA experiment, the VvMYB14-His recombinant protein was obtained using a pEASY-E1 expression vector (TransGen Biotech, Beijing, China) and purified using His-tagged BeaverBeads™ IDA-Nickel (Beaver, BioBay, China). Oligonucleotide probes containing an MBS element (CATGTCCCTGTGAACCTAACGTAAGGCA) and a mutant probe (CATGTCCCTGTGTACATATCGTAAGGCA) were synthesized and labeled with biotin (Sangon, Shanghai, China). EMSAs were performed as described in the instruction manual included with the EMSA kit (Thermo Fisher Scientific, MA, USA) used. All the primers used are listed in Table S1.