Sequences were obtained by using pblastp suite https://blast.ncbi.nlm.nih.gov/Blast.cgi or directly from http://flybase.org and http://www.wormbase.org . Alignment was performed by using the alignment tool of CLC Main Workbench 7.9.1 (Qiagen Bioinformatics). Parameters were kept as default (gap open cost: 10, gap extension cost: 1, end gap cost: as any other). We tested for the appropriate model by using MEGA6.06 [20 (link)]. A Maximum Likelihood tree was constructed via PhyML3.2 [21 (link)] by using the model LG+G ([22 (link)], gamma shape parameter: 0.628) and Bootstrap branch support (100 replicates). The final tree was modified by using CLC Main Workbench 7.9.1 (Qiagen Bioinformatics) and Affinity Designer 1.6.0 (Serif).
Clc main workbench 7
Manufactured by Qiagen
Sourced in Denmark, United States, Germany
CLC Main Workbench 7 is a software application designed for the analysis and visualization of biological data. It provides a comprehensive suite of tools for tasks such as sequence alignment, phylogenetic analysis, and genome assembly. The software is intended to assist researchers in the life sciences field with data management and bioinformatics analysis.
Automatically generated - may contain errors
Lab products found in correlation
Fermentas pcr master mix, by Thermo Fisher Scientific (2 mentions)
S1000 thermal cycler, by Bio-Rad (2 mentions)
Phusion high fidelity pcr master mix, by New England Biolabs (2 mentions)
Qiaquick pcr purification kit, by Qiagen (2 mentions)
Pcr purification kit, by Merck Group (1 mentions)
Sequencher 5, by Gene Codes (1 mentions)
Clc bio, by Qiagen (1 mentions)
Phusion high fidelity pcr master mix with hf buffer, by New England Biolabs (1 mentions)
Hf buffer, by New England Biolabs (1 mentions)
Stata v 13, by StataCorp (1 mentions)
Jmp pro 11, by SAS Institute (1 mentions)
Oligonucleotides for pcr, by Merck Group (1 mentions)
Oligo dt, by Thermo Fisher Scientific (1 mentions)
Superscript 2 reverse transcriptase, by Thermo Fisher Scientific (1 mentions)
Rneasy plant mini kit, by Qiagen (1 mentions)
Dnase 1, by Qiagen (1 mentions)
Abi 3730xl dna sequencer, by Thermo Fisher Scientific (1 mentions)
Miseq desktop, by Illumina (1 mentions)
Nextera xt dna library preparation guide rev d, by Illumina (1 mentions)
Pcr master mix, by Thermo Fisher Scientific (1 mentions)
54 protocols using clc main workbench 7
1
Phylogenetic Analysis of Protein Sequences
2
Mapping Haploblock Regions in Wheat Lr22a
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For the identification of the haploblock region, we mapped previously generated Illumina reads of CH Campala Lr22a and CH Campala [32 (link)] to the Chinese Spring pseudomolecule using CLC Main Workbench 7 (Qiagen) with standard parameters. The mapped read file was later used for the variant call analysis by CLC Main Workbench 7 (Qiagen) using standard parameters. SNP density was calculated in sliding windows of 2.5 Mb. To verify the haploblock c region we designed a PCR probe (forward primer GCCACGAGCGTGGTCGTG, reverse primer CCTTCATAGCTCCGTAGAAG) spanning the left border of the haploblock c of CH Campala Lr22a. The PCR amplification was performed in 20 μl reaction mixture containing 65 ng of genomic DNA, 1 μl of 2.5 mM dNTP’s, 1 μl of 10 μM of each primer and 0.25 units of Sigma Taq polymerase at 60 °C annealing temperature for 35 cycles. The cycling parameters used were pre-denaturation at 95 °C for 4 min, which was followed by 35 cycles of 95 °C for 30 s, annealing at 60 °C for 30 s, 72 °C for 2 min and a final extension at 72 °C for 10 min. The PCR products were separated on 1.0% agarose gels.
3
Bioinformatic Analysis of Grapevine Terpene Synthases
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Sequence analyses were performed using CLC Main Workbench 7 (CLC Bio-Qiagen, Aarhus, Denmark). Phased diploid annotations of the VviTPS family [27 (link)] were queried to identify the cluster of proteins most similar to the sequenced isolates. MUSCLE alignments [72 (link),73 (link)] and phylogenetic tree construction were performed as described earlier using CLC Main Workbench 7 (CLC Bio-Qiagen, Aarhus, Denmark). Gene sequence data and Cytoscape network data were retrieved, as per the instructions in reference [27 (link)]. The I′ score [38 (link)] was calculated from BLASTn [62 (link)] scores of isolates queried against all diploid complete VviTPS genes (mRNA sequences) predicted by reference [27 (link)].
4
Comparative Teleost Beta Gene Sequence Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The cDNAs were analyzed by automated sequencing at Eurofins Genomics GmbH (Ebersberg, Germany). The sequences were edited and analyzed with the CLC Main Workbench 7.7 program (CLC bio, 2016) and deposited in the GenBank database under the accession numbers KY306449 (Cham_beta1), KY306450 (Cham_beta2), KY306451 (Cham_beta5) for C. hamatus, and in the Third Party Annotation Section of the DDBJ/ENA/GenBank databases, under the accession numbers BK009988 (Dlab_beta1), BK009989 (Dlab_beta2), and BK009990 (Dlab_beta5) for D. labrax.
5
Antimicrobial Resistance Genes Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA was extracted by a standard heat lysis protocol and was analysed by PCR for the presence of antimicrobial resistance genes. Synthesis of primers and custom DNA sequencing were carried out by Microsynth (Balgach, Switzerland). Purification of amplicons was performed using a PCR purification kit (Sigma-Aldrich, Buchs, Switzerland). All presumptive carbapenemase-producers were screened for the presence of blaVIM, blaKPC, blaNDM-1 and blaOXA-48 using previously described primers [15, 16] .
Isolates exhibiting an ESBL phenotype were screened for blaTEM, blaSHV and blaCTX-M genes using previously published primers [17, 18] . Presumptive 16S rRNA methylase-producers were analysed for the presence of armA, rmtA, rmtB, rmtC and rmtD as described previously [19] . All isolates were screened for the presence of the plasmid-mediated colistin resistance gene mcr-1 using primers published recently [20] . Nucleotide sequences were analysed with CLC Main Workbench 7.7 (CLC bio, Aarhus, Denmark). Database searches were performed using the BLASTN program of the National Center for Biotechnology Information (NCBI) (http://www.ncbi.nlm.nih.gov/blast/).
Isolates exhibiting an ESBL phenotype were screened for blaTEM, blaSHV and blaCTX-M genes using previously published primers [17, 18] . Presumptive 16S rRNA methylase-producers were analysed for the presence of armA, rmtA, rmtB, rmtC and rmtD as described previously [19] . All isolates were screened for the presence of the plasmid-mediated colistin resistance gene mcr-1 using primers published recently [20] . Nucleotide sequences were analysed with CLC Main Workbench 7.7 (CLC bio, Aarhus, Denmark). Database searches were performed using the BLASTN program of the National Center for Biotechnology Information (NCBI) (http://www.ncbi.nlm.nih.gov/blast/).
6
Identification of Bacterial Species via 16S rRNA Sequencing
7
ESBL Detection in Bacterial Strains
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Bacterial strains confirmed as producing ESBLs were further analyzed by PCR. DNA was purified using a standard heat lysis protocol (Sambrook and Russel, 2006 ). Thereafter, five specific primer sets (custom-synthesized by Microsynth, Balgach, Switzerland) were used to screen for β-lactamase-encoding genes belonging to the blaTEM, blaSHV, and blaCTX-M families (Pitout et al., 1998 (link); Geser et al., 2012 (link)).
Resulting amplicons were purified using the GenEluteTM PCR Clean-Up (Sigma–Aldrich, Buchs, Switzerland) according to the manufacturer’s recommendations. Custom-sequencing was performed by Microsynth (Balgach, Switzerland) and the nucleotide- and translated protein-sequences were analyzed with CLC Main Workbench 7.0.2 (CLC bio, Aarhus, Denmark). For database searches the BLASTN program of NCBI2 was used.
Resulting amplicons were purified using the GenEluteTM PCR Clean-Up (Sigma–Aldrich, Buchs, Switzerland) according to the manufacturer’s recommendations. Custom-sequencing was performed by Microsynth (Balgach, Switzerland) and the nucleotide- and translated protein-sequences were analyzed with CLC Main Workbench 7.0.2 (CLC bio, Aarhus, Denmark). For database searches the BLASTN program of NCBI
8
Arabidopsis Tissue Transcriptome Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Affymetrix Arabidopsis ATH1 22k GeneChip raw data of the female gametophyte cells (Wuest et al., 2010 (link)), young seed compartments (Belmonte et al., 2013 (link)), adult tissues (Le et al., 2010 (link)), and male gametophyte cells (Borges et al., 2008 (link)) were obtained from ArrayExpress in EBI (https://www.ebi.ac.uk/arrayexpress/ ) and Gene Expression Omnibus in NCBI (http://www.ncbi.nlm.nih.gov/geo/ ) websites. The raw data were processed and normalized using GCRMA in R. Hierarchical clustering analysis on ROP genes expression was carried out using CLC Main Workbench 7.02 (CLC bio, Denmark).
9
Chlamydiae 16S rRNA Gene Identification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Identification of chlamydial bacteria was carried out using Chlamydiae-specific 16S rRNA gene primers (Everett et al., 1999 (link); Draghi et al., 2004 (link)). Positive bands were analyzed further only when template free negative controls showed no signal. 16S rRNA gene amplicons were cloned into Topo vector pCR2.1 prior to capillary sequencing from both ends (Microsynth, Balgach). The resulting reads were assembled (CLC Main Workbench 7.0.2, CLC bio, Qiagen), compared using blastn against the Genbank database and used to create alignments with reference sequences using Muscle and PhyML v3 within Seaview v4 (Gouy et al., 2010 (link)). Only unique sequences from each sample were included in the analysis. Representative 16S rRNA gene sequences have been deposited with EMBL with the following accession numbers: LN612731-4 representing 2012Sar3_5c , 2013Arg23_1c , 2013Arg33_2c , and 2013Arg14_4c respectively.
10
Bioinformatic Analysis of Emp Protein
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All sequence analyses were performed using CLC Main Workbench 7.0.2 (Qiagen). The secondary structure of the recombinant (His-tagged) Emp protein sequence was predicted using the Hidden Markov Model (HMM) provided by the CLC Main Workbench. Multiple alignments were performed by applying the Clustal Omega algorithm50 for multiple sequence alignments. Phylogenetic analysis was performed based on maximum likelihood phylogeny tree construction with 100 bootstrap replicates.
The Emp sequence was compared against the NCBI database using the BLAST platform and the blastp tool to identify related proteins.
The Emp sequence was compared against the NCBI database using the BLAST platform and the blastp tool to identify related proteins.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!