Lenti sgrna ms2 zeo backbone

Manufactured by Addgene

The Lenti sgRNA(MS2)_zeo backbone is a plasmid vector designed for the expression of single guide RNAs (sgRNAs) in lentiviral systems. It contains the necessary elements for the production of lentiviral particles and the expression of the sgRNA, including the MS2 aptamer sequence and a zeocin resistance marker.

Automatically generated - may contain errors

Lab products found in correlation

Lenti ms2 p65 hsf1 hygro, by Addgene (2 mentions) Sgrna ms2 cloning backbone, by Addgene (1 mentions) Chromaspin column, by Takara Bio (1 mentions) Oligonucleotides, by Eurofins (1 mentions) Sanger sequencing, by Genewiz (1 mentions) T4 dna ligase, by New England Biolabs (1 mentions) T4 polynucleotide kinase, by New England Biolabs (1 mentions) Lenti dcas9 vp64 blast, by Addgene (1 mentions) Lenti dcas vp64 blast, by Addgene (1 mentions) Hygromycine, by Thermo Fisher Scientific (1 mentions) Zeocin, by Thermo Fisher Scientific (1 mentions) Dcas9 vp64, by Addgene (1 mentions) Hubc dcas9 krab t2a puro vector, by Addgene (1 mentions) Plko 1 vector, by Merck Group (1 mentions) In fusion hd cloning kit, by Takara Bio (1 mentions)

Spelling variants of this product

Lenti sgRNA(MS2)_zeo (5 citations) Lenti-sgRNA(MS2)-zeo backbone plasmid (3 citations) MS2-sgRNA-Zeo (2 citations)

8 protocols using lenti sgrna ms2 zeo backbone

Lentiviral sgRNA Cloning Protocol

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Pairs of oligonucleotides (Eurofins) were annealed and subcloned into either sgRNA (MS2) cloning backbone (Addgene Plasmid #61424) or Lenti sgRNA (MS2)_zeo backbone (Konermann et al., 2015 (link)) (Addgene plasmid # 61427) that were previously digested with either BbsI or BsmBI (NEB), respectively, and purified on a Chromaspin column (Clontech). All constructs were verified by Sanger sequencing (Genewiz). sgRNA sequences are listed in Supplementary Table S1.

Kumar P., Courtes M., Lemmers C., Le Digarcher A., Coku I., Monteil A., Hong C., Varrault A., Liu R., Wang L, & Bouschet T. (2023). Functional mapping of microRNA promoters with dCas9 fused to transcriptional regulators. Frontiers in Genetics, 14, 1147222.

+ Open protocol

+ Expand

CRISPR Activation Screening Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Promoter-targeting guide sequences for the 15 genes used to confirm CRISPR SAM activity were designed with the Cas9 Activator Tool (sam.genome-engineering.org/database) and the oligonucleotides are shown in Supplementary Table 5. Guide sequences for targeting of the screen candidate genes were obtained from the Addgene depositor datasheet (www.addgene.org/pooled-library/zhang-human-sam-v1) and modified by the addition of BsmBI recognition sites (Supplementary Table 6). Oligonucleotide sequences for generation of 20 bp non-targeting (scrambled) guide sequence were kindly shared by Dr Feng Zhang. Double-stranded sequences were generated by phosphorylating and annealing oligonucleotides with T4 polynucleotide kinase (NEB, Cat#M0201) and T4 DNA ligase (NEB, Cat#M0202), respectively. Guide sequences were cloned into the lenti sgRNA(MS2)_zeo backbone (Addgene, Cat#61427) by Golden Gate assembly using BsmBI (NEB, Cat#R0580) and amplified in NEB Stable competent E. coli. A full protocol is available at www.sam.genome-engineering.org/protocols.

Trigg R.M., Lee L.C., Prokoph N., Jahangiri L., Reynolds C.P., Amos Burke G.A., Probst N.A., Han M., Matthews J.D., Lim H.K., Manners E., Martinez S., Pastor J., Blanco-Aparicio C., Merkel O., de los Fayos Alonso I.G., Kodajova P., Tangermann S., Högler S., Luo J., Kenner L, & Turner S.D. (2019). The targetable kinase PIM1 drives ALK inhibitor resistance in high-risk neuroblastoma independent of MYCN status. Nature Communications, 10, 5428.

+ Open protocol

+ Expand

CRISPR-Cas9 Targeting of SLC Transporters

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

SgRNA were cloned into lenti sgRNA(MS2)_zeo backbone (Addgene: 61427). Cloned oligonucleotides, named accordingly to the SLC SAM library ID, were as follows: SLC7A3 (sg3 F caccgGGCTTTGCAAAAGGATTGCG, R aaacCGCAATCCTTTTGCAAAGCCc; sg4 F caccgTGAGGATGGGACGCAGTCTC, R aaacGAGACTGCGTCCCATCCTCAc; sg5 F caccgTAGCGAGGAGGATTGGGGGT, R aaacACCCCCAATCCTCCTCGCTAc); SLC7A5 (sg3 F caccgCCCGCCCCCTCGGCCCAGCT, R aaacAGCTGGGCCGAGGGGGCGGGc; sg4 F caccgGAGGGACGGGGCCGGGCCAC, R aaacGTGGCCCGGCCCCGTCCCTCc; sg5 F caccgGTGCGTCGTCCGGCCCAGCC, R aaacGGCTGGGCCGGACGACGCACc), SLC1A2 (sg3 F caccgAGATCCTGGGCTCCTGCCAC, R aaacGTGGCAGGAGCCCAGGATCTc; sg4 F caccgGGCAGAGGAGGGACCGCGAC, R aaacGTCGCGGTCCCTCCTCTGCCc; sg5 F caccgAAAGGAGTTGCCCGAGGCGG, R aaacCCGCCTCGGGCAACTCCTTTc), sgSLC1A3 (sg1 F caccgCACCCTCGTCTTCCCTGAAA, R aaacTTTCAGGGAAGACGAGGGTGc; sg2 F caccgAGGAAACATGCAATAATGTG, R aaacCACATTATTGCATGTTTCCTc; sg5 F caccgCTCGTAACAGTTGTACAACC, R aaacGGTTGTACAACTGTTACGAGc). sgRen targeting Renilla luciferase cDNA was used as negative-control sgRNA (GGTATAATACACCGCGCTAC) (33 (link)) and cloned into lenti sgRNA(MS2)-zeo backbone (Addgene: 61427) or lenti sgRNA(MS2)-zeo-IRES-eGFP backbone. Codon-optimized cDNAs for human SLC7A3, SLC1A2, and SLC1A3 were obtained from Genscript and cloned in pTO vectors with or without a N- or C-terminal Strep-HA tag.

Rebsamen M., Girardi E., Sedlyarov V., Scorzoni S., Papakostas K., Vollert M., Konecka J., Guertl B., Klavins K., Wiedmer T, & Superti-Furga G. (2022). Gain-of-function genetic screens in human cells identify SLC transporters overcoming environmental nutrient restrictions. Life Science Alliance, 5(11), e202201404.

+ Open protocol

+ Expand

Overexpression and Knockdown of TEAD3 in Cells

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

To overexpress mouse Tead3 in RAW264.7 cells, we used CRISPRa to activate endogenous Tead3 expression, considering that the translation of Tead3 is initiated at a non-AUG start codon^{74 (link),75 (link)}. The sgRNA sequences are listed in Supplementary Data 3. Primers were annealed and ligated into the Lenti sgRNA(MS2)_zeo backbone (Addgene, 61427) digested with BsmBI. RAW264.7 cells were infected sequentially with Lenti dCas9-VP64_blast (Addgene, 61425), and Lenti MS2-P65-HSF1_Hygro (Addgene, 61426), and were selected with blasticidin (10 μg/mL) and hygromycin (750 μg/mL). The surviving cells were then infected with Lenti sgRNA(MS2)_zeo-Tead3 lentivirus and selected with zeocin (1 mg/mL). Tead3 overexpression was verified by qPCR and immunoblotting. For TEAD3 knockdown in U937 cells, the following pLKO-puro constructs inserted with shRNA were purchased from Sigma: TRCN0000015948 (5′-GCCACTGTTCTGCGCTTTAAT-3′), and TRCN0000015949 (5′-CCATGTCTACAAGCTCGTCAA-3′). A non-targeting shRNA in the pLKO-puro backbone was used as the control. Infected U937 cells were selected with puromycin (3 μg/mL).

Zhao Y., Ning J., Teng H., Deng Y., Sheldon M., Shi L., Martinez C., Zhang J., Tian A., Sun Y., Nakagawa S., Yao F., Wang H, & Ma L. (2024). Long noncoding RNA Malat1 protects against osteoporosis and bone metastasis. Nature Communications, 15, 2384.

+ Open protocol

+ Expand

Targeted XIST and MSN Expression Modulation

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Lentiviral vectors expressing shRNA for XIST and MSN were obtained from abm Inc, and Dharmacon, respectively. siRNA targeting MPP1, MSN and MID1 were purchased from Dharmacon. The plasmids expressing dCAS9 (lenti dCAS-VP64_Blast) and MS2 (lenti MS2-P65-HSF1_Hygro), and gRNA backbone plasmid (lenti sgRNA (MS2)_zeo backbone) were obtained from Addgene. The gRNAs targeting XIST promoter were cloned into the backbone plasmid as described previously(15 (link)). gRNA-11 and gRNA-8 target 5′TGTCCGGCTTTCAATCTTCT3′ and 5′GCAGCGCTTTAAGAACTGAA3′, respectively. DNA oligomers were synthesized by Invitrogen. The plasmid expressing miR503 was purchased from System Biology Inc (SBI).

Xing F., Liu Y., Wu S.Y., Wu K., Sharma S., Mo Y.Y., Feng J., Sanders S., Jin G., Singh R., Vidi P.A., Tyagi A., Chan M.D., Ruiz J., Debinski W., Pasche B.C., Lo H.W., Metheny-Barlow L.J., D’Agostino RB J.r, & Watabe K. (2018). Loss of XIST in breast cancer activates MSN-c-Met and reprograms microglia via exosomal microRNA to promote brain metastasis. Cancer research, 78(15), 4316-4330.

+ Open protocol

+ Expand

Single-guide RNA Cloning Protocol

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Single-guide RNAs (sgRNAs) were designed and assembled as described by Konermann et al25 (link), 26 (link). Briefly, sgRNA sequences were synthesized and annealed in a thermal cycler. Then annealed oligo was cloned into lenti sgRNA(MS2)_zeo backbone (a gift from Feng Zhang, Addgene #61427).

Wang J., Jiang X., Zhao L., Zuo S., Chen X., Zhang L., Lin Z., Zhao X., Qin Y., Zhou X, & Yu X.Y. (2019). Lineage reprogramming of fibroblasts into induced cardiac progenitor cells by CRISPR/Cas9-based transcriptional activators. Acta Pharmaceutica Sinica. B, 10(2), 313-326.

+ Open protocol

+ Expand

Generating CRISPR-dCas9 cell lines

Check if the same lab product or an alternative is used in the 5 most similar protocols

E14tg2a cells were infected by a lentivirus contain dCas9-VP64 (Addgene, Cat.N 61425) or empty dCas9 (generating by removing the VP64 from the dCas9-VP64). Four days after infection cells were selected by adding 15ug/ml of basticidine (GIBCO, Cat.N A11139-03) during one week. To generate dCas9-VP64/p65-Hsf1 cell line, dCas9-VP64 positive cells were then additionally infected by lentivirus contain MS2-P65-HSF1 helper protein (Addgene, Cat.N 61426). Four days after infection positive cells were selected by adding hygromycine at 1mg/ml (GIBCO, Cat.N 10687010).
Guide RNAs (Zfp604 – AGAAAGCGGAATGAGAAGTT and Sox4 - TTGCTCTGTAAATTGGAATG) were designed and cloned in lenti sgRNA(MS2) zeo backbone (Addgene, Cat.N 61427) according to Zhang lab protocol (http://sam.genome-engineering.org/). The above mentioned CRISPR-dCas9 cell lines (plus the original E14Tg2a cell line) was infected by the sgRNA lentivirus and selected with 250ug/ml of zeocin (Invitrogen Cat.N R250-01) for 5 days. The first biological Hi-C/RNA replicate was collected one week after the original infection date, while the second was done one passage later (9 days post-infection).

Bonev B., Mendelson Cohen N., Szabo Q., Fritsch L., Papadopoulos G.L., Lubling Y., Xu X., Lv X., Hugnot J.P., Tanay A, & Cavalli G. (2017). Multiscale 3D Genome Rewiring during Mouse Neural Development. Cell, 171(3), 557-572.e24.

+ Open protocol

+ Expand

Engineered CRISPR Activation and Interference

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

To generate the inducible dCas9-p300 expression vector, the p300 core domain was amplified from the pcDNA-dCas9-p300-Core vector (Addgene, #61357) and cloned into MluI/BstXI digested pHR-TRE3G-KRAB-dCas9-P2A-mCherry backbone (59 (link)). To generate the inducible dCas9-LSD1 expression vector, LSD1 open reading frame (ORF) was amplified and cloned into the pHR-TRE3G-KRAB-dCas9-P2A-mCherry to replace the KRAB domain. To generate the enCRISPRa sgRNA vector, the MCP-VP64-IRES-mCherry cassette was amplified from the pJZC34 vector (Addgene, #62331) and cloned into BsrGI/EcoRI digested lenti-sgRNA (MS2)-zeo backbone (Addgene, #61427). Then the mCherry cassette was replaced by puromycin or zsGreen1 by In-Fusion® HD Cloning Kit (Clontech). To generate the enCRISPRi sgRNA vector, the KRAB sequence was amplified from the pLV hU6-sgRNA hUbC-dCas9-KRAB-T2A-Puro vector (Addgene, #71236) and cloned into the enCRISPRa sgRNA vector to replace VP64. The lentiviral shRNAs for PPARG (TRCN0000001673) and RXRA (TRCN0000330707) in pLKO.1 vector were obtained from Sigma-Aldrich.

Li K., Zhang Y., Liu X., Liu Y., Gu Z., Cao H., Dickerson K.E., Chen M., Chen W., Shao Z., Ni M, & Xu J. (2020). Non-Coding Variants Connect Enhancer Dysregulation with Nuclear Receptor Signaling in Hematopoietic Malignancies. Cancer discovery, 10(5), 724-745.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!