Lenti sgrna ms2 zeo backbone
The Lenti sgRNA(MS2)_zeo backbone is a plasmid vector designed for the expression of single guide RNAs (sgRNAs) in lentiviral systems. It contains the necessary elements for the production of lentiviral particles and the expression of the sgRNA, including the MS2 aptamer sequence and a zeocin resistance marker.
Lab products found in correlation
8 protocols using lenti sgrna ms2 zeo backbone
Lentiviral sgRNA Cloning Protocol
CRISPR Activation Screening Protocol
CRISPR-Cas9 Targeting of SLC Transporters
Overexpression and Knockdown of TEAD3 in Cells
Targeted XIST and MSN Expression Modulation
Single-guide RNA Cloning Protocol
Generating CRISPR-dCas9 cell lines
Guide RNAs (Zfp604 – AGAAAGCGGAATGAGAAGTT and Sox4 - TTGCTCTGTAAATTGGAATG) were designed and cloned in lenti sgRNA(MS2) zeo backbone (Addgene, Cat.N 61427) according to Zhang lab protocol (
Engineered CRISPR Activation and Interference
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!