The related genes of ABC transporters and the KSH enzyme (KshA, KshB1, and KshB2) were tested by RT-qPCR. Briefly, B. CQ001 was cultured in media containing dexamethasone sodium phosphate (induced group) and inorganic sucrose broth (non-induced group) at 37°C, 200 r/minute for 24 hours. The total RNA was extracted using RNAprep Pure Bacteria Kit (TIANGEN). cDNA was reverse-transcribed using RT reagent Kit with gDNA Eraser (TaKaRa). RT-PCR was carried out using 2-step method via SYBR Premix Ex Taq II (TaKaRa) and Applied Biosystems 7300 Real Time PCR System (Bio-Rad). The 16S rRNA that stably expressed in different hosts was used as the housekeeping gene. The primers used in this study were listed in Table 1 , which were designed and synthesized in Sangon Biotech Co., Ltd., (Shanghai, China). The relative expression level was calculated as fold change using the 2-ΔΔCt method.
Rt reagent kit with gdna eraser
Manufactured by Takara Bio
Sourced in Japan, China, United States
The RT reagent Kit with gDNA Eraser is a laboratory product designed for RNA extraction and reverse transcription. It includes reagents for the removal of genomic DNA and the conversion of RNA to complementary DNA (cDNA). The kit offers a streamlined workflow for RNA-based analyses.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (17 mentions)
Tb green premix ex taq 2, by Takara Bio (5 mentions)
Trizol, by Thermo Fisher Scientific (5 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (4 mentions)
Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (4 mentions)
Nanodrop spectrophotometer, by Thermo Fisher Scientific (4 mentions)
Sybr green master mix, by Takara Bio (4 mentions)
Sybr green, by Takara Bio (3 mentions)
Rnaiso plus, by Takara Bio (3 mentions)
Tb green, by Takara Bio (3 mentions)
Sybr premix ex taq 2, by Takara Bio (2 mentions)
Minibest universal rna extraction kit, by Takara Bio (2 mentions)
Primestar max dna polymerase, by Takara Bio (2 mentions)
Sybr premix ex taq, by Takara Bio (2 mentions)
Sybr premix ex taq tli rnaseh plus, by Takara Bio (2 mentions)
Sybr green mix, by Takara Bio (2 mentions)
Abi prism 7500 sequence detection system, by Thermo Fisher Scientific (2 mentions)
Abi 7500 system, by Thermo Fisher Scientific (2 mentions)
P211161, by Bioneer (2 mentions)
P291322, by Bioneer (2 mentions)
61 protocols using rt reagent kit with gdna eraser
1
Transcriptional Regulation of ABC Transporters and KSH
2
Quantifying Antioxidant Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells (107 cells/ml) were harvested and resuspended in a 1.5 ml micro-tube containing 1 ml TRIZOL Reagent (Invitrogen, USA). After precipitation in 100% isopropanol and washing in 75% ethanol, the RNA pellet was suspended in a suitable volume of DEPC water according to the manufacturer’s instructions. RNA solutions were quantified using a NanoDrop 3.0.0 (Coleman Technologies Inc., USA). Aliquots were stored at −70 °C.
The transcriptional expression of genes encoding CAT, SOD, POD, CaM, and CAS was measured using real-time RT-PCR43 (link). First strand synthesis was carried out using a PrimeScript RT Reagent Kit With gDNA Eraser according to the manufacturer’s instructions (#RR047A, TAKARA). To perform the gene expression analyses, specific primer sets were designed to produce 100 to 200 bp PCR products (Table S1 ). Quantitative real-time PCR was performed (three technical replicates on five biological replicates) using iTaq Universal SYBR Green Supermix (#172, Bio-Rad) and a Bio-Rad CFX96 Thermal Cycler (Bio-Rad, USA). Differences in expression were calculated according to the ‘delta–delta method’ (Pfaffl 2001), using 18S rRNA and CBLP as references.
The transcriptional expression of genes encoding CAT, SOD, POD, CaM, and CAS was measured using real-time RT-PCR43 (link). First strand synthesis was carried out using a PrimeScript RT Reagent Kit With gDNA Eraser according to the manufacturer’s instructions (#RR047A, TAKARA). To perform the gene expression analyses, specific primer sets were designed to produce 100 to 200 bp PCR products (
3
Quantitative RT-PCR Analysis of Lipogenic Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA of the cells was isolated using the TRIzol method according to the manufacturer’s instructions (Takara, Japan). Reverse transcription was performed using an RT reagent kit with gDNA eraser (Takara) according to the manufacturer’s instructions. Quantitative real-time PCR was performed using a SYBR Green Premix Ex Taq (Takara) according to the manufacturer’s instructions. The data were analyzed by the 2-△△CT method. β-actin was used as an internal reference. Table 1 shows the primer sequences of β-actin, SCD1, SREBP-1c, and fatty acid synthetase (FAS).
Quantitative RT-PCR primers
| Gene | Species | Forward primer | Reverse primer |
|---|---|---|---|
| SREBP-1c | human | GCGCCTTGACAGGTGAAGTC | GCCAGGGAAGTCACTGTCTTG |
| SCD1 | human | AGCTCATCGTCTGTGGAGCC | GCCACGTCGGGAATTATGAGG |
| FAS | human | GGGATGAACCAGACTGCGTG | TCTGCACTTGGTATTCTGGGT |
| β-actin | human | GATGAGATTGGCATGGCTTT | GTCACCTTCACCGTTCCAGT |
4
Comprehensive PHEX Gene Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The aberrantly spliced transcripts were verified by sequencing the entire cDNA of the PHEX gene. An initial cDNA strand was obtained from RT-PCR of total RNA using the RT reagent kit with gDNA Eraser (Takara Biotechnology Co., Kyoto, Japan) under the condition: 37°C for 15 min and 85°C for 5 sec. A total of 2 μl cDNA product was then used as a template to amplify the four overlapping fragments with the four pairs of primers. Primer sequences are listed in Table I . The PCR conditions were as follows: 95°C for 3 min, 95°C for 30 sec, 72°C for 1 min (34 cycles) and 72°C for 5 min. The final PCR products were sequenced and aligned with the coding region of the referenced PHEX gene from the NCBI database.
5
Analysis of Cardiac Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from rat right ventricular tissue and cultured cells using a Total RNA Kit II (R6934-01; Omega Bio-tek, Norcross, GA, USA) according to the manufacturer’s instructions. An RT Reagent Kit with gDNA Eraser (No. RR047A; Takara, Tokyo, Japan) was used for cDNA synthesis. Real-time PCR was performed using All-in-OneTM qPCR Mix (No: QP001; GeneCopoeia, Germantown, MD, USA) according to the manufacturer’s protocol. Most primer sequences are listed in Table 1 . Primers for TNF-α, ARG1, and PLN were purchased from GeneCopoeia (Germantown, MD, USA).
Sequences of Primers Used for Real-Time qPCR Experiments
| Gene | Gene ID | Forward Primer 5′-3′ | Reverse Primer 5′-3’ |
|---|---|---|---|
| NLRP3 | 287362 | GCTGGACCTCAGTGACAATGCC | ACCAATGCGAGATCCTGACAACAC |
| CASP1 | 25166 | ATGGCCGACAAGGTCCTGAGG | GTGACATGATCGCACAGGTCTCG |
| IL-1β | 24494 | AGCAGGTCGTCATCATCC | AATCTCACAGCAGCATCTC |
| IL-6 | 24498 | TCTCGAGCCCACCAGGAACG | AACTGGCTGGAAGTCTCTTGCG |
| iNOS | 24599 | TCACCTTCGAGGGCAGCCGA | CAGACGCCATGGTGCAGGGG |
| Serca2a | 29693 | CAGCCATGGAGAACGCTCA | TCGTTGACCCCGAAGTGG |
| RYR2 | 689560 | TGCTGCGAGCCGGG | TGGCGGTGGCGTAGGA |
| IL-10 | 25325 | AGTGGAGCAGGTGAAGAATG | GAGTGTCACGTAGGCTTCTA |
| CD206 | 4360 | GACGGACGAGGAGTTCATTATAC | GTTGGAGAGATAGGCACAGAAG |
| MCP-1 | 24770 | GCCCAGAAACCAGCCAACTCTC | GCCCAGAAACCAGCCAACTCTC |
6
Quantitative RT-PCR Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was prepared from samples collected using Trizol (Invitrogen) according to the manufacturer’s instructions. The RNA samples were then subjected to cDNA synthesis system with RT reagent Kit with gDNA Eraser (Takara, Dalian, China). A Quantitative RT-PCR Kit was used to establish the qRT-PCR reactions (Qiagen, Valencia, CA, United States). The gene expression levels were normalized to the transcript level of the reference gene ubiquitin5 (LOC_06g46770) gene. All of the primer pairs used for qRT-PCR, which are listed in Supplementary Table S2 , have been tested for efficiency and specificity following the guidelines for successful real time1 . qRT-PCR analysis were performed follow the MIQe guidelines (Bustin et al., 2009 (link)).
7
Detecting Taste Receptors in Gingival Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from fresh gingival tissues (n=8) and cultured HGFs (n=4) with TRIzol regent (Life Technologies, Carlsbad, CA, USA) and MiniBest Universal RNA Extraction Kit (TAKARA, Tokyo, Japan), respectively, according to the manufacturer’s instructions. The precipitate was air-dried and resuspended in RNase-free water. The purity and concentration of isolated RNA were determined by a nanodrop 2000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). cDNA was generated from a total of 1 µg RNA using RT reagent Kit with gDNA Eraser (TAKARA, Tokyo, Japan). Aliquot without reverse transcriptase was prepared as the negative control. PCR was performed using PrimeSTAR® Max DNA Polymerase (TAKARA, Tokyo, Japan) to detect the existence of TAS2Rs and downstream molecules (primers listed in Supplementary Table 1 Supplementary Table 1
8
Quantifying Aortic Inflammatory Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the homogenate of fresh-frozen thoracic aorta without adipose tissue using TRIzol reagents (Invitrogen, 15596026). Afterwards, the RNA was quantified spectrophotometrically (Spectrophotometer, Merinton, SMA4000) and was reverse transcribed into cDNA with RT reagent kit with gDNA Eraser (Takara, RR047A) for qRT-PCR. The primer sequences of IL-6, TNF-α, NF-κB p65/Rela, NF-κB2, Nox2, and Nox4 were used to determine gene expression using TB Green Premix Ex TaqⅡ (Takara, RR820A) in a real-time PCR machine (ABI ViiA 7, Applied Biosystems, Foster City, CA). The program was run with reaction cycling of initial denaturing (95°C, 30 s), followed by 40 cycles of denaturing (95°C, 5 s) and extension (60°C, 30 s). Additionally, a melting curve was run to confirm specificity of PCR products. At last, gene expression levels were normalized to GAPDH expression levels, and the relative quantity of mRNA expression was calculated according to the cycle threshold (2−△△Ct) method. The primer sequences of target genes for amplification are listed in Table 1 .
9
Quantification of KPC-2, OmpK35, and OmpK36 Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PCR was used to amplify the full-length blaKPC-2, ompk35, and ompk36 genes. The Sanger sequencing results were compared with those of standard sequences. Total RNA was extracted from overnight cultures using a Pure Link RNA minikit (Thermo Fisher Scientific, USA), according to the manufacturer’s instructions. cDNA was obtained using a PrimeScript real-time (RT) reagent kit with gDNA Eraser (TaKaRa, Kyoto, Japan). Quantitative PCR (qPCR) was performed using TB Green premix Ex Taq (TaKaRa, Kyoto, Japan) on the CFX96 real-time PCR system. Relative gene expression levels were calculated using the 2–ΔΔCT formula with the rpoB gene as the internal control. All samples were analyzed in triplicate. The blaKPC-2 expression level in the BAA-1705 strain was used as a reference.
10
Quantitative RT-PCR analysis of gene expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quantitative RT-PCR analysis of selected genes was performed using SYBR green method (TransStart Top Green qPCR SuperMix, TransGen Biotech, Beijing, China) on an ABI PRISM 7900HT (Applied Biosystems, Inc.). The isolated RNA of 3 individuals either from the control group or from the diabetic animals was reverse-transcribed into cDNA using the RT reagent Kit with gDNA Eraser (Takara, DRR047A) in a total volume of 20 μL containing 2 μg of total RNA, following the manufacturer protocol. The cDNA was diluted 20-fold and 2 μL was used as template in subsequent qRT-PCR reactions. Each sample was analyzed in triplicate with the following reaction conditions: 30 seconds at 95°C, followed by 40 cycles of 5 seconds at 95°C, 30 seconds at 60°C, and 20 seconds at 72°C. A dissociation curve was drawn for each primer pair. Relative expression levels of interested genes were determined using 2−ΔΔCt method, and the gene expression levels were normalized to β-actin measured in parallel.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!