Transcriptor first strand synthesis kit

RNA was extracted from paraffin-embedded samples using RecoverAll™ Total Nucleic Acid Isolation Kit for FFPE (Invitrogen). Contamination with genomic DNA was removed using DNAse I treatment according to the manufacturer’s protocol. Aboult 300 ng of total RNA was used for the first-strand cDNA synthesis using Transcriptor First Strand Synthesis kit (ROCHE) and oligo-dT primer and random hexamer mix. Transcript levels of studied genes were measured in triplicates using Applied Biosystems 7500 Fast device with specific primers and SybrGreen. For SMARCA2, following primers were used hBRMq2F: TCCGAGGCAAAATCAGTCAAG and hBRMq2R: TTCCTCGATTTGGCCTTTTCT. As the reference primers UBI1: ATTTGGGTCGCGGTTCTTG and UBI2: TGCCTTGACATTCTCGATGGT specific for UBI (UBIQUITIN) gene were used. For the relative expression level calculation, the 2^−ΔΔCt method was used.

RNA was isolated using RNA Mini Kit (Bio&SELL, Germany), and total mRNA was reversely transcribed using Transcriptor First Strand Synthesis Kit (Roche, Germany). Primer specificity was confirmed by separating PCR amplification products in an agarose gel. Quantitative real-time PCR was performed using the Fast Sybr Kit (Kapa Biosystems, MA, U.S.A.) and a LightCycler 480 (Roche, Germany). Gene specific primers for BAX, BBC3, GADD45, and CDKN1A were used [44 (link)–47 (link)] at a concentration of 200 nM (Suppl. Table 1). The samples were preincubated at 95°C for 3 min, followed by 40 amplification cycles of 10 s denaturing at 95°C, 30 s annealing at 55°C, and amplification for 1 s at 72°C. Finally, a melting curve was performed with five acquisitions/°C from 65°C to 97°C. All samples were performed in triplicates. To calculate relative gene expression, the data of the threshold cycles was analyzed using the ΔΔC_T method.

RNA extraction and quality analyses were performed as mentioned before [21 (link)]. 1 μg RNA was reverse transcribed using the Transcriptor First-Strand Synthesis Kit (Roche). The PCR were performed by ALLin™ Hot Start Taq Polymerase Kit (highQu, Kraichtal, Germany) in a total volume of 25 μl containing 1 μl of first-strand cDNA solution, 0.5 μl of ALLin Hot Start Taq Polymerase (5 u/μl), 5 μl of 5X-ALLin PCR Buffer, 2 μl each of the PCR primers (10 pmol/μl), and 14.5 μl H₂O. The reactions were initiated by heating the samples to 95°C for 60 s, followed by 40 cycles at 95°C for 15 s, 55–65°C for 15 s, and 72°C for 15 s and an extension at 4°C for 10 min. The products were analyzed on 2% agarose gels in Tris-borate-EDTA buffer and visualized by ethidium bromide staining. The sense (forward (FP)) primer is common for the two isoforms, whereas the antisense (backward (BP)) primers are selective for the L or the S isoform, respectively. Following oligonucleotide, primers were used in order to amplify the different isoforms as previously described [22 (link)]: humanCEACAM1_FP49: 5′-GCAACAGGACCACAGTCAAGACGA-3′, humanCEACAM1_BP60: 5′-GTGGTTGGAGACTGAGGGTTTG-3′ and humanCEACAM1_BP59: 5′-TGGAGTGGTCCTGAGCTGCCG-3′. For quantification of CEACAM1-4L/4S ratio, a triple-primer PCR procedure was used as previously described [22 (link)].

For the validation of candidates from the DGRP, offspring was collected after eclosion and maintained at controlled densities of 20 total flies, aged to 3–5 days and snap frozen on dry ice. 10 to 15 fly heads were used per replicate for RNA extraction. For subsequent qPCR experiments concerning the RDGN transcription factors, flies were aged until 12–15 days old and only female flies were used for qPCR experiments. For larval qPCR, staged larvae (see below) were collected and all organs except the brain were dissected out. Each replicate is 5–6 larvae.
Total RNA was isolated using TRI reagent (Invitrogen) and reverse transcription was performed on 1μg RNA using Transcriptor First Strand Synthesis kit (Roche). Primer sequences used are listed in Table 2. qPCR was performed on a Step-One-Plus using the SYBR Green detection system. Transcript levels were normalized to Rp49 transcript levels (initial screen) or using the geometric means of ​RpS13 & Rp49 (transcription factor experiments). Mean ΔCt values were statistically compared as described below. Relative quantitation of transcript levels to control genotypes were calculated using the ΔΔCt method and plotted with GraphPad Prism software to visualize expression differences.

RNA was extracted from cell lines using the High Pure RNA Isolation Kit (Roche, Basel). 1 μg of extracted RNA was reverse transcribed into cDNA using the Transcriptor First Strand Synthesis kit (Roche). Quantitative RT-PCR was performed in triplicate using SYBR green mix (Qiagen, Hilden) on an ABI 7500 machine (Applied Bio Systems, Foster City). Data was analyzed using Microsoft Excel and graphed using the Prism software package. The following primer sequences were used: SRGAP2 (for: aggaggaagcatggaggatt, rev: ttcatcatcgcttgtgtggt), Gapdh (for: gtgttcctacccccaatgtgt, rev: gagacaacctggtcctcagtgt). Data was graphed and analyzed using the Prism software package. Two-tailed, unpaired t-tests were used to determine statistical significance (p < 0.05).