The total RNA was extracted using TRIzol reagent. An equivalent of 1 µg of total RNA was subjected to reversed transcription into cDNA using PrimeScript™ RT reagent Kit (Takara, Kyoto, Japan) and Mir-X™ miRNA qRT-PCR SYBR® Kit (Takara, Kyoto, Japan). The mRNA expression of the target gene was determined by qRT-PCR conducted on the ABI-7900 system with SYBR Green (Takara, Kyoto, Japan). The expression of a target gene was normalized to that of GAPDH.
Abi 7900 system
Manufactured by Takara Bio
Sourced in China
The ABI 7900 System is a real-time PCR instrument designed for quantitative gene expression analysis. It provides precise and sensitive detection of target sequences in real-time. The system utilizes TaqMan or SYBR Green chemistries for target amplification and detection.
Automatically generated - may contain errors
Lab products found in correlation
Sybr green, by Takara Bio (5 mentions)
Trizol, by Thermo Fisher Scientific (4 mentions)
Primescript rt reagent kit, by Takara Bio (2 mentions)
Sybr green rt pcr assay, by Takara Bio (2 mentions)
Mir x mirna qrt pcr sybr kit, by Takara Bio (1 mentions)
Primescript rt master mix, by Takara Bio (1 mentions)
Reverse transcription system, by Takara Bio (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
8 protocols using abi 7900 system
1
Quantification of Gene Expression by qRT-PCR
2
Quantifying Gene Expression in Head and Neck Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We used TRIzol to obtain total RNA from fresh human head and neck squamous cell carcinoma tissues and paracancerous tissues, and then reverse transcribed into cDNA. The human tissues got from the patients consented to this study during the time of surgery from January 2020 to December 2020 in Quanzhou First Hospital Affiliated to Fujian Medical University. It is considered by the Ethic Committee of the Quanzhou First Hospital Affiliated to Fujian Medical University. Ethics Committee agrees the program to carry out as planned [No. (2019) 109]. The Quantitative real-time PCR was performed on an ABI 7900 system (Takara, Dalian, China) with SYBR Green using SYBR Green RT-PCR Assay (Takara, Dalian, China) and normalized to GAPDH. The following primers were used for PCR: ZNF566, forward primer: 5′-ctcgacatcacagaattcacac-3′; and reverse primer: 5′-tctgatgtcgagtgaagtttga-3′; TMEM150C, forward primer, 5′-gagaccagcctgaccaatgtgaag-3′ and reverse primer, 5′-ctgcctccgcctcctgagtag-3′; ENDOU, forward primer, 5′-ttacagtcacatctcgccttta-3′ and reverse primer, 5′-ggagtagagtgcaaactcaaac-3′. MALSU1, forward primer, 5′-ttctacccgacacttacatgccatgand-3′ and reverse primer, 5′-ccacgcacagccagtcatcag-3′.
3
Quantification of gene expression in ESCC
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Trizol (Invitrogen, USA) was used to extract mRNA from the ESCC tissues or cells, and the extracted mRNA samples were reversely transcribed into cDNA templates. Quantitative real-time PCR was performed using an ABI7900 System with SYBR Green (SG; TaKaRa, China). The primers were as follows: Cyclin D1 forward: TGTGCATCTACACCGACAACTC, Cyclin D1 reverse: TGGAAATGAACTTCACATCTGTG; SOX17 forward: GGTTTTTGTTGCTGTTG, SOX17 reverse AACTTGGAAATAGGGTTTTGAC;VE-cadherin forward: TACCAGCCAAGTTGTGA, VE-cadherin reverse: GCCGTGTTATCGTGATTATCC; and β-actin forward: 5′-CTGGGCTACACTGAGCACC,β-actin reverse: AAGTGGTCGTTGAGGGCAATG.
4
Quantitative Analysis of SPAG6 and NM23 Expression in Osteosarcoma
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA of fresh osteosarcoma tissues and cells in the test and control group was obtained using TRIzol (Invitrogen, Carlsbad) and then reverse-transcribed to cDNA using the reverse transcription system (Bao et al., 2019 (link)). The expression of SPAG6 was determined using the SYBR Green RT-PCR Assay (Takara, Dalian, China) and normalized to GAPDH (glyceraldehyde 3-phosphate dehydrogenase) as described previously (Ma et al., 2019 (link)). Quantitative real-time PCR was implemented on an ABI 7900 System with SYBR Green (Takara, Dalian, China). The primers used in the PCR are as follows: SPAG6, forward primer, 5′-AGC AAT GGC AGT CAT CAT TTC-3′ and reverse primer, 5′-GGA TGA ATG GTC GGG AAC TT- 3′; NM23, forward primer, 5′-ACGCTTGCTCTGTTTGTGG-3′ and reverse primer, 5′-CTGGAAGGCACACCATCC-3'; and GAPDH, forward primer, 5-CAG CCT CAA GAT CAGCA-30 and reverse primer, 5′-TGT GGT CAT GAG TCC TTC CA-3′.
5
RNA Extraction and qRT-PCR Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from sorted cells with Trizol and reverse transcribed into cDNA with the Reverse Transcription System (Takara, Japan). Real-time RT-qPCR was performed on an ABI 7900 System with PrimeScript RT Master Mix (Takara).
6
Quantitative analysis of SOX4, SOX17, and VE-cadherin
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Trizol (Invitrogen, USA) was used to extract mRNA from ESCC tissues or cells, and the extracted mRNA samples were reversely transcribed into cDNA templates. Quantitative real-time PCR was performed using an ABI 7900 System with SYBR green (TaKaRa, China). The primers for SOX4 were as follows:
AGCAAGAAGGCGAGTTAGTT (forward, 5-3′) and TGACCAAGA AGCAAAATAAAA (reverse, 5′-3′). The primers for SOX17 were as follows: GGTTTTTGTTGCTGTTG (forward, 5′-3′) and AACTTGGAAATAGGGTTTTGAC (reverse, 5′-3′). The primers for VE-cadherin were as follows:
TACCAGCCAAGTTGTGA (forward, 5′-3′) and GCCGTGTTATCGTGATTATCC (reverse, 5′-3′). The transcript levels were quanti ed by normalization to GAPDH expression (5′-CTGGGCTACACTGAGCACC, forward, 5′-3′ and AAGTGGTCGTTGAGGGCAATG, reverse, 5′-3′) as an internal standard.
AGCAAGAAGGCGAGTTAGTT (forward, 5-3′) and TGACCAAGA AGCAAAATAAAA (reverse, 5′-3′). The primers for SOX17 were as follows: GGTTTTTGTTGCTGTTG (forward, 5′-3′) and AACTTGGAAATAGGGTTTTGAC (reverse, 5′-3′). The primers for VE-cadherin were as follows:
TACCAGCCAAGTTGTGA (forward, 5′-3′) and GCCGTGTTATCGTGATTATCC (reverse, 5′-3′). The transcript levels were quanti ed by normalization to GAPDH expression (5′-CTGGGCTACACTGAGCACC, forward, 5′-3′ and AAGTGGTCGTTGAGGGCAATG, reverse, 5′-3′) as an internal standard.
7
Quantifying Gene Expression in ESCC
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Trizol (Invitrogen, USA) was used to extract mRNA from ESCC tissues or cells, and the extracted mRNA samples were reversely transcribed into cDNA templates. Quantitative real-time PCR was performed using an ABI 7900 System with SYBR green (TaKaRa, China). The primers for SOX4 were as follows: AGCAAGAAGGCGAGTTAGTT (forward, 5-3′) and TGACCAAGA AGCAAAATAAAA (reverse, 5′-3′). The primers for SOX17 were as follows: GGTTTTTGTTGCTGTTG (forward, 5′-3′) and AACTTGGAAATAGGGTTTTGAC (reverse, 5′-3′). The primers for VE-cadherin were as follows:
TACCAGCCAAGTTGTGA (forward, 5′-3′) and GCCGTGTTATCGTGATTATCC (reverse, 5′-3′). The transcript levels were quanti ed by normalization to GAPDH expression (5′-CTGGGCTACACTGAGCACC, forward, 5′-3′ and AAGTGGTCGTTGAGGGCAATG, reverse, 5′-3′) as an internal standard.
TACCAGCCAAGTTGTGA (forward, 5′-3′) and GCCGTGTTATCGTGATTATCC (reverse, 5′-3′). The transcript levels were quanti ed by normalization to GAPDH expression (5′-CTGGGCTACACTGAGCACC, forward, 5′-3′ and AAGTGGTCGTTGAGGGCAATG, reverse, 5′-3′) as an internal standard.
8
Rat Knee Cartilage RNA Extraction and Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from rat knee articular cartilage with Trizol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions. The purity and quantity of the RNA preparation were assessed by measuring the absorbance at 260 and 280 nm. Total RNA was reverse-transcribed with the PrimeScript RT Reagent kit (TaKaRa, Dalian, China). Real-time PCR was then performed using an ABI 7900 System in the presence of SYBR-Green (TaKaRa, Dalian, China) following the manufacturer's instructions in an Eco Real Time PCR System (Illumina China, Shanghai, China). The mRNA level of individual genes was normalized and presented as a ratio to GAPDH. Quantitative RT-PCR data were calculated using the 2-ΔΔCT method. The primer sequences are listed in Table 1.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!