Plasmid purification mini kit
The Plasmid Purification Mini Kit is a lab equipment product designed for the rapid and efficient isolation of plasmid DNA from bacterial cultures. The kit utilizes a silica-based membrane technology to purify plasmid DNA, providing a simple and reliable method for DNA extraction.
Lab products found in correlation
12 protocols using plasmid purification mini kit
Cloning and Sequencing of Date Palm CLO Genes
Sequencing Analysis of scFv Clones
Viral Integration Site Identification
eGFP- L: 5′- GATCCCTCAGACCCTTTTAGTCAGTG -3′
Same cycling condition as the second round.
Taq polymerase-amplified PCR products were inserted into the plasmid vector pCR4-TOPO using the TOPO TA Cloning Kit (Invitrogen). Subsequently, chemically competent TOP10 E. coli cells were transformed with the vector carrying the PCR products. The transformation mixture was spread on agar plates and incubated overnight at 37 °C. Ten to twenty colonies from each plate were expanded in 10 ml LB medium containing ampicillin. The amplified constructs were extracted with the QIAGEN Plasmid Purification Mini-Kit, digested with EcoR I, and run on agarose gel. Bands of different molecular weight were identified in 7 of the 8 hearts examined. DNA sequencing was performed to verify the presence of viral integration sites.
Detecting Antibiotic Resistance Genes
(5'TTGCAGCTTTTCAAGAATGCGC-3'),blaOXA-1 (5'AATGGCACCAGATTCAACTT-3') and (5'-CTTGGCTTTTATGCTTGATG-3'); and blaSHV (5'-GGTTATGCGTTATATTCGCC-3') and (5'-TTAGCGTTGCCAGTGCTC-3'). blaCTX-M genes were screened by using a multiplex PCR assay [14] .
CRISPR-Cas9 Knockout of HuR in MIA Cells
Construction and Characterization of OXA-48 Producing E. coli
Plasmid Purification and Replicon Typing
Characterization of OXA-48 Carbapenemase Resistance
For a functional resistance profile, the native and mutated blaOXA-48 genes were cloned in the pCR-blunt II-TOPO vector (Invitrogen, CA) and expressed in
Dual Selection Plasmid Library Construction
Cloning and Sequencing of NColE7 Mutants
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!