Fusionfx detection system

RNA:DNA unwinding assay was performed as described (54 (link)). In brief: RNA:DNA hybrids were annealed in vitro in 5 mM Tris/HCl pH 8.5. The sequence of the top RNA strand was: 5′‐GAAGCUGGGACUUCCGGGAGGAGAGUGCAA‐3′, and the sequence of the bottom DNA strand was 5′-CGGGTTGTCAAGAATTTTAACGGCCATTTCTGTGTTGCACTCTCCTCCCGGAAGTCCCAGCTTCTGTGTTTGTGACAAACGCAAGCTCATGTAAGTGCTC‐3′. The annealed RNA:DNA hybrid has a 5′ ssDNA overhang and is labeled with Cy-5. Unwinding experiments were carried out at 30°C for 60 min in 30 mM Tris–HCl (pH 7.5), 50 mM NaCl, 5 mM MgCl₂, 2 mM DTT, 0.01% NP‐40, 0.1 mg/ml BSA, 4 mM ATP, 1 nM Cy-5‐labeled RNA:DNA hybrid substrate, in the presence of 4.79 μM recombinant DDX19A. The reaction was stopped by the addition of SDS to a final concentration of 0.5% and 20 ng proteinase K (20 mg/ml). The reaction was afterward loaded onto a 10% non-denaturing polyacrylamide gel and analysed using a FusionFX detection system (VILBER).

To obtain whole cell lysates, cells were extracted six days after transduction by use of Mammalian Protein Extraction Reagent (M-PER, Thermo Fisher Scientific) and subjected to at least three freeze-thaw cycles (− 80 °C/room temperature). Samples were run on a sodium-dodecyl sulfate/ 10% polyacrylamide gel and blotted onto a Westran S polyvinylidene difluoride membrane (GE Health Care). After blocking for 24 h in a 5% milk solution, proteins of interest were detected by incubation for 24 h with antibodies against MAP3K7, NF-κB p100/p52, NF-κB p105/p50, IκB (all Cell Signaling) used at a 1:1000 dilution in 5% milk/TBS-T (Tris-buffered saline with 0.5% Tween-20) or 5% BSA (bovine serum albumin)/TBS-T for phospho NF-κB p65 Ser536 (Cell Signaling). Incubation for 1 h with a peroxidase-conjugated anti-mouse or anti-rabbit antibody (both Sigma) was followed by signal detection with Western Lightning Plus-ECL detection reagent (PerkinElmer) using the Fusion FX detection system (Vilber Lourmat). ImageJ (1.48v) was used for quantification of results.

For the analysis of protein levels, cells were harvested 13 days after transduction and antibiotic selection. Pellets were lysed in cell lysis buffer (Cell Signaling Technology^®) for 30 min on ice. After 10 and 20 min of incubation, the lysate was sonicated with an EpiShear Probe Sonicator (Active Motif) for 2 cycles of 20 s to release nuclear protein. The lysate was centrifuged at 15 000 × g for 10 min, the supernatant was mixed with 2× SDS sample buffer (125 mM Tris–HCl pH 6.8, 5% SDS, 0.004% Bromophenol Blue, 10% β-mercaptoethanol, 100 mM DTT, 20% glycerol) and boiled at 95°C for 10 min. Proteins were resolved by SDS-PAGE on a 12% polyacrylamide gel. Proteins were transferred to an Immobilon-FL PVDF membrane at 300 mA for 90 min using a wet-tank blotting system (BioRad). Proteins were detected using a target specific primary antibody at manufacturer′s recommendations in combination with a species-specific HRP- or IRDye^® 800CW-coupled secondary antibody. Imaging was performed on a FusionFX detection system (VILBER) using SuperSignal™ West Femto Chemiluminescence substrate (ThermoFisher Odyssey^® CLx imaging system (LI-COR).