96 well fast pcr plates

cDNA was generated with SuperScript IV reverse transcriptase (Invitrogen, ThermoFisher Scientific), random hexamer primers (ThermoFisher Scientific), 10 nM dNTPs Mix (ThermoFisher Scientific) and RNaseOUT (Invitrogen, ThermoFisher Scientific) in accordance with manufacturer’s instructions. Enrichment of specific RNA was determined by qPCR in a 7500 Fast Real-Time PCR System (Applied Biosystems, ThermoFisher Scientific) on 96-well fast PCR Plates (Sarstedt) using Fast SYBR™ Green Master Mix (Applied Biosystems, ThermoFisher Scientific) and the following primers, TERC For: GTGGTGGCCATTTTTTGTCTAAC, TERC Rev: TGCTCTAGAATGAACGGTGGAA, scaRNA2 For: GGTTGGAGCGTGTTAGGC, scaRNA2 Rev: GGAGGAGACCTTTTCATTTCG, scaRNA5 For: TGAATGTCACGGTCCCTTTGT, scaRNA5 Rev: AGCTGCTCCATGATCCCATAC, β-actin For: AGAGCTACGAGCTGCCTGAC, β-actin Rev: AGCACTGTGTTGGCGTACAG, GFP For: CTCCTGCCCGACAACCAC, GFP Rev: TCACGAACTCCAGCAGGAC.

cDNA was generated with the SuperScript IV reverse transcriptase (Invitrogen, ThermoFisher Scientific), random hexamer primers (ThermoFisher Scientific), 10 nM dNTPs Mix (ThermoFisher Scientific) and RNaseOUT (Invitrogen, ThermoFisher Scientific) in accordance with the manufacturers´ instructions. The levels of specific species of RNA were determined by RT-qPCR in a 7500 Fast Real-Time PCR System (Applied Biosystems, ThermoFisher Scientific) using 96-well fast PCR Plates (Sarstedt) and Fast SYBR™ Green Master Mix (Applied Biosystems, ThermoFisher Scientific). The primers employed are listed in Supplementary Table 3.