Dreamtaq master mix 2x

Detection of trypanosomes was done using the same crushed homogenates used for bloodmeal analysis. Amplification of trypanosome DNA was performed in a 10 μL reaction-volume comprising of 1 μL DNA template, 5 µL DreamTaq Master Mix (2X) (Thermo Scientific, UK), and 0.5 μL at 10 μM of each Forward and Reverse ITS-1 primers (CF: CCGGAAGTTCACCGATATTG, BR: TTGCTGCGTTCTTCAACGAA) [47 (link)]. Cycling conditions for DNA amplification were initial denaturation for 1 min at 95 °C, followed by 35 cycles of denaturation at 95 °C for 30 s, annealing at 60 °C for 20 s, and extension at 72 °C, and a final extension at 72 °C for 7 min. PCR-products were visualized following 1.5% agarose-gel electrophoresis against a molecular weight maker (Gene-Ruler 100 bp DNA ladder, Thermo Scientific, Lithuania) and ethidium bromide staining (5 µg/mL). Where trypanosome infections were present, the parasite species were characterized by the following unique band sizes: T. vivax ~250 bp, T. godfreyi ~300 bp, T. simiae Tsavo ~370 bp, T. simiae ~400 bp, Trypanozoon (T. brucei sp.) ~480 bp, T. congolense Kilifi ~620 bp, and T. congolense Savannah/Forest ~700 bp [47 (link)]. To confirm trypanosome identity, amplicons were cleaned using Exo-SAP (USB Corporation, Cleveland OH) to remove unincorporated dNTPs and PCR primers and thereafter sent for Sanger sequencing of the ITS1gene [47 (link)].

Small segments of mouse tails (0.5 ~ 1.0 cm) were collected and digested in 150 μL of DNA-lysis buffer with 0.2 mg/ml of proteinase K for overnight at 56 °C. Then, DNA samples were diluted 50 times and mixed with DreamTaq master mix (2X) (Thermofisher) following vendor protocol for genotyping PCR. Then, DNA electrophoresis was performed in 2% agarose gel. Bands detection was performed using imaging system ChemiDoc (Bio-Rad). All primers used in this procedure are noted in Supp Table S1.

DNA was extracted from the whole blood using salting out (non-enzymatic) method and SNP genotyping was confirmed via T-ARMS PCR, previously adopted in our lab [25 (link), 26 ]. Specific primers were designed using primer blast software for each SNP (Table 1). The PCR mixture (10μL) was prepared, consisting of 5μL master mix (Thermo Fisher Scientific, DreamTaq Master Mix (2X), 0.5μL of each forward and reverse primer, 3μL of ddH₂O and 1μL of template DNA. The PCR condition were, initial denaturation at 95°C for 5min. followed by 35 cycles, denaturation at 95°C for 30 sec. annealing for 30 sec. at 61°C, 63°C and 60°C for OPG rs2073618, rs3102735 and RANKL rs9533156 respectively, extension 72°C for 30 sec. and final extension at 72°C for 7min. The amplified PCR products were run and confirmed using 1.5% gel electrophoresis with 1KB DNA ladder (Thermo Fisher Scientific).