The largest database of trusted experimental protocols

Lightcycler 480 system

Manufactured by Takara Bio
Sourced in Japan, China, United States

The LightCycler 480 system is a real-time PCR instrument designed for high-throughput nucleic acid quantification and analysis. It features a 96-well plate format and a high-intensity, multilaser optical system for sensitive detection of fluorescent signals.

Automatically generated - may contain errors

26 protocols using lightcycler 480 system

1

Quantitative RNA Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from the panicle tissues of ZZY10, ZZB, and Z7-10. RNA of the three samples was reverse transcribed into double-stranded cDNA with a PrimeScript™ RT reagent kit with a gDNA Eraser kit (TaKaRa Bio, Ohtsu, Japan). SYBR-based qRT-PCR (Takara, Japan) was carried out with the SYBR® Premix Ex Taq™ II kit (Takara Bio, Ohtsu, Japan) and a LightCycler 480 system. The reaction procedure was as follows: 95 °C for 30 s, 95 °C for 30 s, and 60 °C for 30 s (40 cycles). The results of the relative quantification experiments were analyzed by the ∆Ct method. The rice gene ACTIN1 was used as an internal control.
+ Open protocol
+ Expand
2

Quantitative RNA Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from wheat or Arabidopsis samples using Trizol reagent (Invitrogen, Carlsbad, CA, USA). RNA was first purified and then checked for integrity. For RT-qPCR, total RNA was reverse-transcribed to cDNA using the FastQuant RT Kit (Tiangen, Beijing, China). RT-qPCR was carried out in a Roche LightCycler480 system using SYBR Premix Ex Taq kit (TaKaRa, Shiga, Japan). Reactions were set up using the following thermal cycling profile: 95 °C for 30 s followed by 40 cycles of 95 °C for 5 s, 58 °C for 30 s, and 72 °C for 34 s. Each experiment was replicated three times. The relative expression of the target genes was calculated using the 2−ΔΔCT method [44 (link)], with the wheat Actin gene (TaActin) or Arabidopsis actin gene (AtActin) used as the internal reference genes for the analysis.
+ Open protocol
+ Expand
3

Quantifying mRNA and microRNA Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
In order to verify the expression of PTEN at mRNA level, total RNA was extracted from cells by using TRIzol Reagent (Invitrogen) and reversely transcribed into cDNA with PrimeScript RT reagent Kit With gDNA Eraser (Takara) according to the manufacturer’s instructions. However, the RNA extracted by miRNeasy Mini Kit (Qiagen) was reversely transcribed into cDNA using MiRNA-X miRNA First-Strand Synthesis Kit (TaKaRa) for microRNA verification. Then, qRT-PCR was performed on a Light Cycler 480 system by using SYBR Premix Ex Taq (Takara) according to the manufacturer’s instructions. U6 and ACTIN were used to normalize the expression of miRNAs and PTEN respectively. The relative expression was calculated using the 2−△△CT method and the primers were listed in Table 2.

Primer sequences for qRT-PCR

Primer Sequences
microRNA-200b-3p5’GCTAATACTGCCTGGTAATGATGA3’
microRNA-200c-3p5’CTAATACTGCCGGGTAATGATGGA3’
U6F: 5’GCTTCGGCAGCACATATACTAAAAT3’
R: 5’CGCTTCACGAATTTGCGTGTCAT3’
PTENF: 5’TGGATTCGACTTAGACTTGACCT3’
R: 5’GGTGGGTTATGGTCTTCAAAAGG3’
ACTINF: 5’TTCGAGCAAGAGATGGCCA3’
R: 5’CGTACAGGTCTTTGCGGAT3’
+ Open protocol
+ Expand
4

Quantitative PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was extracted by the TRIZOL-chloroform extraction method from cells and used as templates for cDNA synthesis using the first-stranded cDNA synthesis kit (Invitrogen, Carlsbad, CA, USA). Real-time PCR was performed in a LightCycler480 System using a SYBR Premix ExTaq kit (Takara, Shiga, Japan). GAPDH was used as an internal control. Gene-specific primers were purchased from IGE Biotechnology (Guangzhou, China) and listed in Table 4:

The sequences of primers used for QPCR in this study.

Gene (official symbol)PrimerSequence
NPY1RForwardTACCAGCGGATCTTCCCCAC
ReverseAATTTGTCTTTTTCGCTCCTGC
GREB1ForwardGGGATCTTGTGAGTAGCACTGT
ReverseCATACGGGAAGGAGGTCACG
MYBForwardCACAGAACCACACATGCAGC
ReverseGCAGAGATGGAGTGGAGTGG
CA8ForwardCCCAGCTACAGATAGAAGAATTTCG
ReverseCACTAAGAGGCTGAGTGGGC
SERPINA3ForwardATGGGAGATGCCCTTTGACC
ReverseCATGGGCACCATTACCCACT
RBM24ForwardAGATGCACACGACCCAGAAG
ReverseCGATCTCGCCGAAGACCTC
GFRA1ForwardCTGCGCATTTACTGGAGCAT
ReverseGAATGTGCTCCACTTGCTGAA
ESR1ForwardTGTTGAAACACAAGCGCCAG
ReverseGGTTGGCAGCTCTCATGTCT
ANKRD11ForwardTCCTTCGCACCTTCCAGTTC
ReverseGGTTCTTGGCCTTGTGCTTG
HDAC3ForwardAATGCCTTCAACGTAGGCGA
ReverseGGGTTGCTCCTTGCAGAGAT
+ Open protocol
+ Expand
5

Mature miRNA Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
The total RNA was extracted using TRIzol (Life Technologies, USA) according to the manufacturer's instructions. The reverse transcription was performed using transcriptase (Life Technologies, USA), and the real-time PCR was performed in a LightCycler480 System using a SYBR Premix ExTaq kit (Takara, Shiga, Japan). Bulge-Loop™ miRNA qPCR Primer Sets purchased from RioboBio (Guangzhou, China) were used in the mature miRNA reverse transcription and qPCR. U6 small nuclear RNA was used as an internal control.
+ Open protocol
+ Expand
6

Quantification of Plasma mtDNA in AKI

Check if the same lab product or an alternative is used in the 5 most similar protocols
Renal tissues were separately collected from the control group, the CI-AKI group, and the rhSTC1 treatment group. mtDNA was extracted and measured as previously described [6 (link)]. Plasma DNA from rats of each group was collected by using the QIAamp DNA Mini and Blood Mini Kit (Qiagen, Germantown, MD), and plasma mtDNA were calculated by quantitative PCR through a LightCycler480 System with SYBR Premix Ex Taq II (Takara, Japan). The relative abundances of plasma mtDNA were indicated as threshold cycles (Tc). And higher Tc represents lower levels of mtDNA.
+ Open protocol
+ Expand
7

RNA Extraction and qPCR Analysis of RAW264.7 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
The total RNA from RAW264.7 cells was extracted using the TRIzol reagent (Thermo Fisher Scientific, Shanghai, China) following the manufacturer’s protocol. According to the manufacturer’s instructions, cDNA was synthesized with the main mixture of ReverTra Ace® qPCR RT Master Mix (Toyobo, Shanghai, China). Real-time PCR was performed on a Roche LightCycler 480 system by using SYBR® Premix Ex Taq™ II (Takara, Dalian, China), and the relative mRNA expression of each gene was normalized to GAPDH.
+ Open protocol
+ Expand
8

Validating DEG Analysis via qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols
To validate the results of DEG analysis, qPCR experiments were performed on a Roche LightCycler 480 system using SYBR-GREEN1 fluorescent reagents (TaKaRa, Otsu, Shiga, Japan). All designed primers were synthesized at Beijing Liuhe Huada Genomics Technology Co., Ltd. (Beijing, China) (Table S2). The BmactinA3 gene was used as the endogenous control [52 (link)]. qPCR reactions (25 μL) consisted of a denaturation step at 95 °C for 10 min, followed by 40 cycles of 95 °C for 15 s, 55 °C for 15 s, and 72 °C for 45 s. Three biological replicates were performed for each gene, and relative fold changes were determined using the 2−ΔΔCt method [53 (link)].
+ Open protocol
+ Expand
9

RNA Isolation and qRT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
The total RNA was isolated from cultured cells using a TRIzol reagent (Invitrogen) according to the established protocol [21 (link)]. The total RNA (1 μg) was reversely transcribed to cDNA using PrimeScript RT Master Mix (Takara, China). Then, qRT-PCR was carried out in a Roche Light Cycler 480 system with SYBR Premix Ex Taq TM (Takara). The primer sequences are shown in Supplementary Table S3. Relative gene expression levels were calculated by normalization to GAPDH and quantification via the 2−△△Ct method.
+ Open protocol
+ Expand
10

Extraction and Quantification of Wheat Total RNA

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from wheat using Trizol reagent (Thermo Fisher Scientific Life Sciences Solutions, CA, USA). RNA was first purified and then checked for integrity. For RT-qPCR, total RNA was reverse-transcribed to cDNA using the FastQuant RT Kit (Tiangen Biotech Co., Ltd., Beijing, China). RT-qPCR was carried out in a Roche LightCycler480 system using the SYBR Premix Ex Taq kit (Takara Biomedical Technology (Beijing) Co., Ltd, Beijing, China). Reactions were set up using the following thermal cycling profile: 95 °C for 30 s followed by 40 cycles of 95 °C for 5 s, 58 °C for 30 s, and 72 °C for 34 s. Each experiment was replicated three times. The relative expression of the target genes was calculated using the 2−∆∆CT method, with the wheat Actin gene (TaActin) used as the internal reference gene for the analysis. Primers are listed in Table S4.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!