For siRNA-mediated XRN2 or RRP6 gene silencing, the model cell lines derived from Hek293 Flp-In T-REx cells or parental cells were grown to 30%–40% confluence, either in the absence or in the presence of doxycycline, and subjected to Stealth siRNA (Invitrogen; respective IDs: HSS176944 and HSS182420) transfection. Scrambled Stealth RNAi siRNA duplex (Invitrogen, cat. no. 12935200) was used as a negative control. Transfections were performed in Ø100 mm culture dishes using Lipofectamine RNAiMAX (Invitrogen) and 20 nM siRNA according to the manufacturer's recommendations.
Stealth rnai sirna duplex
Manufactured by Thermo Fisher Scientific
The Stealth RNAi siRNA duplex is a laboratory reagent designed for gene silencing experiments. It is a synthetic double-stranded RNA molecule that can be used to temporarily suppress the expression of a target gene in cells. The core function of the Stealth RNAi siRNA duplex is to induce RNA interference, a biological process in which RNA molecules inhibit gene expression or translation, by neutralizing targeted mRNA molecules.
Automatically generated - may contain errors
3 protocols using stealth rnai sirna duplex
1
siRNA-mediated XRN2 and RRP6 Silencing
2
Lentiviral Overexpression and Knockdown of SGO1 in NRVMs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Lentiviruses were used to overexpress wild type SGO1 and mutant SGO1 (K23E) in NRVMs. The cells were cultured for 6 h to permit cell attachment to the coverslips or plates. For overexpression experiments, the lentiviruses were added to NRVM cultures and incubated for 24 h. The medium was then refreshed with normal medium lacking lentivirus. MOI = 50 was used in overexpression experiments. To knock down SGO1 in NRVMs, the medium was refreshed into Opti-medium without FBS before transfection. The cells were then transfected with siRNA or scrambled RNA at 100 nM per well in 24-well plates with Lipofectamine RNAiMAX (Life Technologies). After 24 h, the Opti-medium was replaced by M199 with 10% FBS. The siRNA (Stealth RNAi™ siRNA Duplex, Invitrogen) sequences are listed below (5ʹ−3ʹ): 1. UUUCAGUGUACACAGCUGGCAGGUG, 2. CACCUGCCAGCUGUGUACACUGAAA. Stealth RNAi™ siRNA Negative Control Med GC Duplex (Invitrogen, #12935112) was used as scrambled control RNA.
3
Knockdown of DNA repair genes in mammalian cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Control siRNA (no target in mammalian cells, R0017) was purchased from Abnova, Walnut, CA. siRNA against atr (5′AACGAGACTTCTGCGGATTGCAGCA3′) and msh2 (5′AATCTGCAGAGTGTTGTGCTTAGTA3′) were supplied by Invitrogen (Stealth RNAi siRNA duplex). SiRNA against xrcc1 (M-009394-01-0005), ape1 (M-010237-00-0005), mlh1 (J-003906-10-0005), pcna (D-003289-10-0005, M-003289-02-0005 for rescue), apobec3b (J-017322-08-0005), apobec3c (J-013711-08-0002) and apobec3f (J-019039-17-0005) were purchased from Dharmacon RNAi Technologies / GE Healthcare, Fairfield, CT.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!