Total RNA was extracted using RNeasy Mini Kit (Qiagen) and treated with the on-column RNase-Free DNase Set (Qiagen) according to the manufacturer’s instructions. RNA concentration was then measured using NanoDrop and 1 μg of total RNA per sample was subsequently used to perform a two-step reverse transcription polymerase chain reaction (RT-PCR) using random hexamers and First Strand cDNA Synthesis Kit (Thermo Fisher Scientific). Each qPCR reaction contained PerfeCTa SYBR Green FastMix ROX (Quantabio), forward and reverse primer mix (200 nM final concentration) and 6 ng of analyzed cDNA and was set up in triplicates in MicroAmp Fast Optical 96-Well or 384-Well Reaction Plates with Barcodes (Applied Biosystems). The sequences of primers used were as follows: NANOG (hNANOG_FOR624 ACAGGTGAAGACCTGGTTCC; hNANOG_REV722 GAGGCCTTCTGCGTCACA), SOX2 (hSOX2 _FOR907 TGGACAGTTACGCGCACAT; hSOX2_REV1121 CGAGTAGGACATGCTGTAGGT), OCT4A (hOCT4A_FOR825 CCCACACTGCAGCAGATCA and hOCT4A_REV1064 ACCACACTCGGACCACATCC), KLF4 (hKLF4_FOR1630 GGGCCCAATTACCCATCCTT and hKLF4_REV1706 GGCATGAGCTCTTGGTAATGG), TBP (hTBP_FOR896 TGTGCTCACCCACCAACAAT; hTBP_REV1013 TGCTCTGACTTTAGCACCTGTT). Data were collected using QuantStudio 6 Flex Real-Time PCR Instrument and analyzed using corresponding software (Applied Biosystems). Relative amounts of specifically amplified cDNA were calculated using TBP amplicons as normalizers.
Perfecta sybr green fastmix rox
Manufactured by Quantabio
Sourced in United States, Germany
PerfeCTa SYBR Green FastMix ROX is a real-time PCR reagent formulation that contains all the necessary components for efficient and sensitive SYBR Green-based qPCR assays, including a thermostable DNA polymerase, SYBR Green I dye, and ROX passive reference dye.
Automatically generated - may contain errors
Lab products found in correlation
Steponeplus real time pcr system, by Thermo Fisher Scientific (8 mentions)
Nanodrop, by Thermo Fisher Scientific (6 mentions)
Qscript cdna synthesis kit, by Quantabio (4 mentions)
Rneasy mini kit, by Qiagen (2 mentions)
Rneasy plus mini kit, by Qiagen (2 mentions)
Ariamx real time pcr system, by Agilent Technologies (2 mentions)
Quantstudio real time pcr analyzer, by Thermo Fisher Scientific (2 mentions)
Qscript cdna supermix, by Qiagen (2 mentions)
Mirneasy mini kit, by Qiagen (2 mentions)
Steponeplus, by Thermo Fisher Scientific (2 mentions)
Stepone real time pcr system, by Thermo Fisher Scientific (2 mentions)
Direct zol rna miniprep plus, by Zymo Research (2 mentions)
Iscript cdna synthesis kit, by Bio-Rad (2 mentions)
Superscript 3 reverse transcriptase, by Thermo Fisher Scientific (2 mentions)
Fast sybr green master mix, by Thermo Fisher Scientific (2 mentions)
Accustart 2 pcr supermix, by Quantabio (2 mentions)
Viia 7 real time pcr system, by Thermo Fisher Scientific (2 mentions)
Dnase 1, by Roche (2 mentions)
Quantstudio 3, by Thermo Fisher Scientific (2 mentions)
Revertaid rt kit, by Thermo Fisher Scientific (2 mentions)
27 protocols using perfecta sybr green fastmix rox
1
Quantitative RT-PCR Analysis of Pluripotency Genes
2
RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from cells using Qiagen RNeasy Plus Mini kit (Cat. #74134; GmbH) as used and reported in [16 (link)]. The qScript cDNA Synthesis Kit (Cat#95047-100, Quanta Bio, Beverly, MA, USA) was used to convert 1 µg mRNA into cDNA. qRT–PCR was performed using the PerfeCTa SYBR Green FastMix ROX (Cat #95073-012, Quanta Bio, Beverly, MA, USA), according to the manufacturer’s protocols (18). Expression levels of β-Actin were used as an internal control. Real-time analysis was performed with an AriaMx Real-Time PCR System (Agilent AriaMx Real-Time PCR System) using the primers (Table S2 ) ordered from Integrated DNA Technologies (IDT), Leuven, Belgium).
3
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated through a phenol:chloroform phase separation protocol as detailed in the TRIzol Reagent User Guide. RNA concentrations were measured by NanoDrop (Thermofisher, MA). 1,000ng of cDNA was synthesized using the qScript cDNA Synthesis kit (QuantaBio, MA) as detailed in the qScript cDNA Synthesis kit Manual. Exon-exon-spanning primers targeting as many splice variants as possible were designed with Primer-BLAST (National Center for Biotechnology Information, MD). qPCRs were performed in triplicate with 30 ng of cDNA and a master mix of exon-spanning primers (Supplementary Table 1) and PerfeCTa SYBR Green FastMix ROX (QuantaBio, MA) on an QuantStudio real-time PCR analyzer (Invitrogen, MA), and results were expressed as fold change (2−ΔΔCt) relative to the β-actin gene (Actb).
4
Quantitative PCR for Microbial Community
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The positive mock bacterial control dilution series was further analyzed by quantitative PCR. Degenerate primers were modified from the original 515F-806R primer pair by removal of the linker, pad, barcode, and adapter sequences [32 (link)]. (Primer sequences—forward: GTGYCAGCMGCCGCGGTAA; reverse: GGACTACNVGGGTWTCTAAT) Real-time quantitative PCR was done using PerfeCTa SYBR Green FastMix ROX (Quanta Bio, Catalog 95073-012) using a 384-well format on an ABI 7900HT machine. All samples were run in triplicate wells. Run setup was based on Quanta Bio’s product manual using standard cycling (95 °C for 3 min, followed by 40 cycles of 95 °C for 15 s, 50°for 60 s). We used 5 μL of template per reaction for a final reaction volume of 20 μL per sample. A plasmid-encoded single-copy 16S rRNA gene standard was used at the following concentrations (copies/5 μL): 0, 102, 103, 104, 105, 106, and 107.
5
Quantifying Gene Expression in Mouse Neurospheres
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from mouse neurospheres was isolated using the miRNeasy mini kit (Qiagen; Catalog # 217004). cDNA synthesis was performed using the qScript™ cDNA SuperMix (Qiagen; Catalog # 95048). qPCR was performed using a 10 µl mix of cDNA, PerfeCTa® SYBR® Green FastMix®, ROX™ (Quanta Bio: Catalog # 95073‐250), and gene appropriate primers (Table 1 ). qPCR analysis was performed on an Applied Biosystem ViiA 7 Real‐time PCR system (ABI/Life Technologies). RNA expression values of mean 2−∆∆CT were normalized to β‐actin. Primers were designed to span exon–exon junctions and for each primer pair, thermal stability curves were assessed for evidence of a single amplicon. The length of each amplicon was verified using agarose gel electrophoresis, and amplicon identity was verified by Sanger sequencing.
6
Quantitative PCR Protocol for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total cellular RNA was prepared by phenol/chloroform extraction using 250 µl TRI-Reagent (Sigma-Aldrich) according to the manufacturer’s protocol. cDNA was transcribed from 800 ng RNA using the RevertAid™ H Minus First Strand cDNA Synthesis Kit (Fermentas). Quantitative PCR was performed in an Applied Biosystems StepOnePlus Real-Time PCR System (Thermo Fisher Scientific) using the PerfeCTa SYBR®-Green FastMix ROX (Quantabio). All procedures were conducted according to the manufacturers’ protocols with 4 µl cDNA (diluted 1:10 with nuclease-free water), 1 µl primers (5 µM; see Table SI ) and 5 µl SYBR-Green master mix. A pre-incubation for 15 sec at 95°C was followed by 40 amplification cycles: 10 sec at 95°C, 10 sec at 55°C and 10 sec at 72°C. The melting curve for PCR product analysis was determined by rapid cooling down from 95°C to 65°C, and incubation at 65°C for 15 sec prior to heating to 95°C. To normalize for equal mRNA/cDNA amounts, PCR reactions with target-specific and with actin-specific primer sets were always run in parallel for each sample, and target levels were determined by the ΔΔCq method (32 (link)).
7
Quantitative Transcript Analysis for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
cDNA was prepared using the Maxima RT kit (ThermoFisher), relative transcript abundance evaluated using PerfeCTa SYBR green FastMix Rox (QuantaBio). The primer pairs used to amplify each transcript were taken from PrimerBank87 (link): Gapdh (AGGTCGGTGTGAACGGATTTG, GGGGTCGTTGATGGCAACA), Rpl7 (CTGCTGGGCCAAAAACTCTCA, CCTTCAACTCTGCGAAATTCCTT), Cdkn1a (CCTGGTGATGTCCGACCTG, CCATGAGCGCATCGCAATC), Cdkn1b (TCAAACGTGAGAGTGTCTAACG, CCGGGCCGAAGAGATTTCTG), Ccne1 (CTCCGACCTTTCAGTCCGC, CACAGTCTTGTCAATCTTGGCA).
8
Validating RNA-seq Results Using qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Eight candidate genes were chosen for qPCR. qPCR was performed on the same cDNA libraries used for Illlumina sequencing to validate the RNAseq results. Primers were designed using NCBI primer designing tool (http://www.ncbi.nlm.nih.gov/tools/primer-blast/ ) and synthesized at the Iowa State DNA facility (http://www.dna.iastate.edu/ ). Primers to chn1, elavl3, chata, phox2bb, syn2a, amy2a, fli1a, and hprt1 were designed to span exon-exon junction and give a single product of 150–200 bp. Individual qPCR reactions were carried out with the standard StepOnePlus (Applied Biosystems™) cycling protocol using PerfeCTa SYBR® Green FastMix, ROX (Quantabio) according to manufactures instructions. For each qPCR run, the Cycle threshold (Ct) were exported into Microsoft excel for statistical analysis. We used 2-ΔΔCt method of relative quantification to estimate copy number of selected genes [77 (link)]. The expression levels were normalized to zebrafish (Danio rerio) hypoxanthine phosphoribosyltransferase 1 (hprt1) as a reference gene [78 (link)].
9
Fecal DNA Extraction and Quantitative PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total DNA was extracted from approximately 100 mg of feces by using the Zymo fecal DNA miniprep kit according to the manufacturer’s instructions (Zymo Research). Negative controls for detection of kit contamination were included and failed to produce visible PCR bands in an agarose gel but were analyzed as quality controls. Quantitative PCR was carried out using standard curves of known cultures prepared by serial dilution and extracted in the same manner as the fecal samples. Individual samples were analyzed in duplicate under the conditions listed in Table 5 . Reactions were carried out in 20-µl volumes with PerfeCTa SYBR green FastMix ROX (QuantaBio; Beverly, MA USA) or TaqMan universal master mix II, with uracil-N-glycosylase (Thermo Fisher Scientific; Waltham, MA, USA), in 5 µl of extracted DNA in a QuantStudio 3 qPCR machine (Thermo Fisher Scientific; Waltham, MA, USA).
10
Quantitative RT-PCR of Gene Expression
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!