Sirna

Three types of siRNA used in this study were designed and synthesized by Tsingke Biotechnology. To verify the transfection efficiency, siRNAs were diluted to a final concentration of 50 nM and transfected into N2a cells according to the manufacturer’s instructions. The specific target sequence for siACSL4-1 was 5′ - CGCUAUGGCAAAGAGAAUA - 3′, and siACSL4-2 sequence was 5′ - GCAGAGAUAUC AUGCUUUA - 3′, and siACSL4-3 sequence was 5′ - CACACCGAUUCAUGAAUGU - 3′.

SIRT1 cDNA was generated from pCMV-SIRT1-t1-Flag (purchased from Sino Biological) via PCR amplification and then cloned into the FuGW vector by using Seamless Cloning Kit (Beyotime, D7010M) according to the manufacturer’s instructions and confirmed by DNA sequencing. Cells were transfected with constructed SIRT1 plasmid using lipofectamine 3000 (ThermoFisher Scientific, L3000001). After transfection for 24 h, cells were stimulated by Aβ. The knockdown of SIRT1 was performed by the transfection with specific siRNA (Tsingke Biotechnology Co., Ltd.) using lipofectamine 3000.
The cloning primers were as follows:
Forward, TGGGCTGCAGGTCGACTCTAGAATGGCA GATGAAGCAGCTCTC;
Reverse, TTGATATCGAATTCTAGACTATGATTTGTTTGA TGGATAGTTCATGTCT;
The siRNA primers were as follows:
siSIRT1-1: Forward, CACCUGAGUUGGAUGAUAUTT;
siSIRT1-1: Reverse, AUAUCAUCCAACUCAGGUGTT;
siSIRT1-2: Forward, GUCUGUUUCAUGUGGAAUATT;
siSIRT1-2: Reverse, UAUUCCACAUGAAACAGACTT;

HCC cell lines PLC/PRF/5 and Huh7 were purchased from ATCC (Rockville, MD, USA). Human normal liver cell lines LO2 and MIHA and HCC cell lines MHCC97H, HepG2, and Hep3B were obtained from the Liver Cancer Institute, Zhongshan Hospital, Fudan University (Shanghai, China). Dulbecco’s modified eagle medium (DMEM, HyClone, Logan, UT, USA) containing 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin (HyClone, Logan, UT, USA) was used as the culture medium. The cells were grown in a humidified 5% CO₂ incubator at 37 °C. When specified, siRNA (Tsingke, Beijing, China) was transfected into cells at 50–100 nM using LipoRNAi reagent (Beyotime, Shanghai, China). Fresh medium was replaced 6 h after transfection, cells were collected at 24 h or 48 h for RNA extraction and 48 h for WB assays, and other experiments were conducted 24 h later after transfection.

Rat cardiomyocytes H9C2 (CBP60588, Cobioer) cells were maintained in a DMEM medium (D5796,Sigma) supplemented with 10% FBS (10099141, Gibco) and multiplied at 37°C at 5% CO₂. Penicillin and streptomycin (SV30010, Beyotime) were added to prevent bacterial contamination. The cells were randomly divided into six groups: control, erastin, H/R, ATV, erastin + ATV, and H/R + ATV groups. The cells were treated differently according to groups. The cells erastin and erastin + ATV groups were treated with erastin (5 μM) for 24 h [16 (link)]. The steps of cell hypoxia/reoxygenation (H/R) stimulation were as follows: H9C2 cells were exposed to hypoxia (1% O₂/94% N₂/5% CO₂) for 4 h, followed by oxygen for 2 h [17 (link)]. The working concentration of ATV was 1 μM, and the incubation time was 24 h [18 (link)].
In order to study the mechanism of ATV, the cells were divided into four groups: H/R, H/R + SMAD7i, H/R + ATV, and H/R + SMAD7i + ATV groups. SMAD7i were constructed by transfecting siRNA targeting SMAD7 into H9C2 cells. siRNA targeting rat SMAD7 (5′-AGGCAUUCCUCGGAAGUCATT-3′) and the negative control (NC) were synthetic by Tsingke Biotechnology Co., Ltd. [19 (link)]. Lipofectamine 2000 (12566014, ThermoFisher) reagent diluted with a serum-free medium was used to aid transfection. DMEM containing FBS was replaced 4 h after transfection.

The siRNA used to silence mouse BDNF (forward: 5′-GGACGGUCACAGUCCUAGATT-3′, reverse: 5′-UCUAGGACUGUGACCGUCCTT-3′) and a negative siRNA control were obtained from Tsingke Biotechnology Company, China. For in vitro BDNF knockdown, the primary cortical neurons were transfected with siRNA against BDNF or the negative control siRNA using Lipofectamine RNAiMAX reagent (Invitrogen Life Science, United States) according to the recommendations of the manufacturer. Three days later, cells were harvested for qRT-PCR or immunocytochemistry assays as indicated. We also observed development of glutamatergic pyramidal neurons and GABAergic interneurons under this transfection after 12 DIV by immunocytochemistry assays. Total ribonucleic acid (RNA) was extracted with TRIzol reagent, and PrimeScript™ RT Master Mix (TaKaRa, Japan) was used to reverse transcribe the total RNA (500 ng) into complementary DNA. Real-time PCR was carried out using a StepOnePlus™ Real-Time PCR Instrument (Thermo, United States) with 2X Universal SYBR Green Fast qPCR Mix (ABclonal, United States). The sequences of the primers used were as follows:

To generate MCF-7 and MDA-MB-231 cells with GNPNAT1 knockdown, cells transfection was performed by Lipofectamine 2000 (Invitrogen, USA) according to the manufacturer’s instructions. The siRNA targeting GNPNAT1 and control siRNA were purchased from Tsingke Biotechnology Co., Ltd. (China). The sequences for siGNPNAT1 are 5′-GAGUCAGAAUACAGCUACA(dT)(dT)-3′.