High capacity rt pcr kit
The High Capacity RT-PCR Kit is a laboratory equipment designed for reverse transcription and polymerase chain reaction (RT-PCR) applications. It enables the conversion of RNA to complementary DNA (cDNA) and subsequent amplification of target sequences.
Lab products found in correlation
5 protocols using high capacity rt pcr kit
Validating Pde3b Knockout in Tissues
RNA Isolation and qRT-PCR Analysis
Real-Time PCR Analysis of AMH Expression
AMH | Sense 5’- GCTGCCTTGCCCTCTCTAC | 117 | NM_000479.3 |
Antisense, 5’- GAACCTCAGCGAGGGTGTT | |||
β-actin | Sense, 5’- CCTGGACTTCGAGCAAGAGA | 117 | NM_001101.3 |
Antisense, 5’- CAGCGGAACCGCTCATTGCCAATGG |
RNA Extraction and qPCR Analysis
CD4+ T Cell Isolation and qPCR Analysis
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!