Inducible Cdc42-FLARE cell line was seeded in six-well dishes 60 h before imaging at 50% confluency. At 48 h before imaging, the cells were induced with 300 µg/ml cumate (Systems Biosciences), and cumate concentration was maintained constant throughout the experiment. For protein depletion assays, 48 h before imaging, cells were transfected with RNAi using Oligofectamine. For protein expression, ∼18 h before imaging, cells were transiently transfected with ARHGAP10 constructs using Lipofectamine 3000 (Life Technologies) or the cerulean control using X-treme Gene 9. At 24 h before imaging, cells were transferred to a µDish35 mm, high with Grid-500 (81166; Ibidi), which was used for live imaging and locating the previously imaged cells after fixation.
Cumate
Manufactured by System Biosciences
Cumate is a laboratory reagent that is used as a chemical inducer in gene expression systems. It functions by activating the cumate-inducible gene expression system, allowing for controlled and regulated expression of target genes in various cell lines and organisms.
Automatically generated - may contain errors
Lab products found in correlation
Fetal bovine serum (fbs), by Thermo Fisher Scientific (4 mentions)
Dulbecco modified eagle medium (dmem), by Thermo Fisher Scientific (4 mentions)
Plx4720, by Selleck Chemicals (2 mentions)
Mk2206, by MedChemExpress (2 mentions)
Isopropyl β d 1 thiogalactopyranoside (iptg), by Thermo Fisher Scientific (2 mentions)
Gnf 2 gnf 5, by Selleck Chemicals (2 mentions)
Su6656, by Merck Group (2 mentions)
Mk 2206, by Selleck Chemicals (2 mentions)
Sch772984, by Selleck Chemicals (2 mentions)
Nilotinib, by Novartis (2 mentions)
Pb cuo mcs ires gfp ef1α cymr puro, by System Biosciences (2 mentions)
Mycoalert kit, by Lonza (2 mentions)
Lipofectamine 2000 reagent, by Thermo Fisher Scientific (2 mentions)
Grid 500, by Ibidi (1 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (1 mentions)
Panx1, by OriGene (1 mentions)
Myc panx1, by OriGene (1 mentions)
Pcdh cuo mcs ef1 gfp lentiviral vector, by System Biosciences (1 mentions)
Mouse laminin, by Thermo Fisher Scientific (1 mentions)
Rock inhibitor y 27632, by Bio-Techne (1 mentions)
15 protocols using cumate
1
Inducible Cdc42-FLARE Cell Imaging
2
Culturing Human Cell Lines for Experimentation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human embryonic kidney 293T (ATCC, CRL-3216) and U2OS (ATCC, HTB-96) cells were maintained in a humidified incubator at 37°C with 5% CO2 in culture medium consisting of DMEM (Thermo Fisher Scientific) with 10% FBS (Thermo Fisher Scientific), penicillin-streptomycin, and additional selective antibiotics where specified. Furthermore, stable U2OS cell lines expressing Golgi enzyme chimeric reporters under a cumate-inducible promoter were maintained in the presence of 60 µg/ml cumate (System Biosciences). Cells were passaged every 3–4 d, at which time they were treated with trypsin at 37°C for 2 min, resuspended in culture medium, and diluted by a factor of 1:10. Cells were regularly screened to confirm they were mycoplasma negative using the MycoAlert kit (Lonza).
3
Inducible AR-V7 Expression in LNCaP Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The cumate-inducible wildtype or mutant AR-V7 expression constructs were individually packaged into lentiviral particles in 293T cells, and the lentivirus particles were used to transduce LNCaP cells as described previously [50 (link)]. At 48 hr after transduction, 1 μg/ml puromycin was added to the medium to start selection, and the selection continued for two weeks to obtain polyclonal colonies of resistant cells. AR-V7 was expressed by exposing the cells to 1x cumate (System Biosciences).
4
Overexpression of PANX1 in Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
pcDNA3.1-MCS-Bir*A(R118G)-HA was a gift from Kyle Roux (plasmid #36047, Addgene, Cambridge, MA) [31 (link)]. PANX1 cDNA (Origene, Rockville, MD) was subcloned into pcDNA3.1-MCS-BirA*(R118G)-HA. PANX1-BirA*(R118G)-HA, and Myc-PANX1 cDNA (Origene) were subcloned into the pCDH-CuO-MCS-EF1-GFP lentiviral vector (System Biosciences, CA). All constructs were verified by sequencing. See “Supplementary Material and methods” for detailed information.
Transfections were performed using Lipofectamine 2000 Reagent (Thermo Scientific, Waltham, MA). SparQTM Cumate Switch Inducible System (System Bioscience) was used to generate stable cell lines [10 ]. Cumate (System Bioscience) was used at 30 µg/mL.
Transfections were performed using Lipofectamine 2000 Reagent (Thermo Scientific, Waltham, MA). SparQTM Cumate Switch Inducible System (System Bioscience) was used to generate stable cell lines [10 ]. Cumate (System Bioscience) was used at 30 µg/mL.
5
Differentiation of Neural Stem Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
NAG-NSCs were grown until confluent and then detached using TrypLE Express Enzyme (Gibco) and plated onto a T-650 flask coated with 50 μg/ml poly-D-lysine (Sigma-Aldrich) and 10 μg/ml mouse laminin (ThermoFisher). Cells were plated at a density of 0.7 × 108–1.0 × 108 cells/flasks in Neuron Differentiation Media supplemented 100 μg/ml Cumate (System Biosciences), 1 μM PD0332991 cell cycle inhibitor (Tocris), and 10 μM Y27632 Rock inhibitor (Tocris). Cells were differentiated for 5–7 days with one half volume differentiation media changed every 3 days.
6
Combination Inhibitor Protocol for Cancer
7
CEACAM1 Overexpression in A20 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
NheI and NotI restriction sites were generated at the 5′ and 3′ ends, respectively, of the Ceacam1-2L cDNA (kindly provided by Dr. Nicole Beauchemin, McGill University, Montreal, Canada), by PCR utilizing the following primers: 5′CTAGCTAGCTAGGAGACATGGAGCTGGC3′ and 5′ATAGTTTAGCGGCCGCTCACTTCTTTTTTACTTCT3’. The Cumate switch inducible vector (PB-Cuo-MCS-IRES-GFP-EF1α-CymR-Puro, System Biosciences, Palo Alto, CA) was digested with NheI and NotI, and NheI-NotI-digested Ceacam1-2L fragment was cloned into it. The transfectants were generated by electroporation of A20 cells with this construct. Overexpression of CEACAM1 in the cells was induced by addition of Cumate (System Biosciences).
8
Combination Inhibitor Protocol for Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Nilotinib was provided by Novartis (Basel, Switzerland). MK-2206 (Akt inhibitor; in vitro studies), GNF-2/GNF-5 (allosteric Abl/Arg inhibitors), SCH772984 (ERK inhibitor) and PLX-4720 (BRAF inhibitor) were from Selleck (Houston, TX). Some studies utilized PLX-4720 from Plexxicon (Berkeley, CA). MK-2206 (in vivo studies) was from MedChem Express (Monmouth Junction, NJ). SU6656 was from Millipore (Billerica, MA). Captisol was from Ligand Pharmaceuticals (San Diego, CA). Cumate was obtained from Systems Biosciences, and IPTG from Invitrogen (Carlsbad, CA).
9
Affinity Purification of Biotinylated Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The following reagents were purchased from the manufacturers as noted: cumate (System Biosciences); biotin and Dynabeads® MyOne streptavidin C1 (Thermo); ethanolamine and anti-FLAG M2 Affinity Gel (Sigma); and CHX (Wako).
10
CEACAM1 Overexpression in A20 Cells
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!