Bbsi restriction enzyme

gRNAs targeting Exon 2 (position 120-142 and 125-157) of murine Cdkn2a (sequence from Ensembl genome browser 97) were designed using CRISPRdirect^{65 (link)} (gCdkn2a_1: 5′-gcgtcgtggtggtcgcacagg-3′, gCdkn2a_2: 5′-gacacgctggtggtgctgcac-3′). As a control a previously described gRNA targeting GFP gRNA targeting GFP (sgRNA target site sequence: 5′-gggcgaggagctgttcaccg-3′)^{66 (link)} was used. The DNA oligos were ordered from Sigma Aldrich. Equimolar amounts of complementary DNA oligos were annealed and phosphorylated in T4 ligation buffer (NEB). The reaction was performed at 37 °C for 30 min, 95 °C for 5 min, followed by a gradual temperature reduction to 25 °C (5 °C/min). The vector pSpCas9(BB)-2A-GFP (pX458; Addgene plasmid ID: 48138) was digested with the BbsI restriction enzyme (NEB) and dephosphorylated using Calf Intestinal Alkaline Phosphatase (NEB). The ligation reaction (NEB) was performed overnight. The plasmids were sequenced (Microsynth Seqlab) with a hU6 sequencing primer (LKO.1 5′: gactatcatatgcttaccgt). For transfection, plasmid DNA was generated by using the Qiagen EndoFreeMaxi Kit.^{66 (link)} The primary RT2-cell lines were transfected using the Quiagene Effectene Transfection Reagent.