Rabbit anti qki antibody

RAW 264.7 cells (1 × 10⁷) were stimulated with bacteria for 6 h and harvested and re-suspended in 1.28 M sucrose, 40 mM Tris–HCl at pH 7.5, 20 mM MgCl2, and 4% Triton X-100 for 20 min on ice. Cells were centrifuged at 2500×g for 15 min and the cell pellet was lysed in RIP buffer (150 mM KCl, 25 Mm Tris at pH 7.4, 5 mM EDTA, 0.5 mM DTT, 0.5% NP40) and centrifuged at 13,000 rpm for 10 min. Then the rabbit anti-QKI antibody (Bethyl Laboratories) or rabbit IgG (Bethyl Laboratories) was added to the supernatants and incubated for 2 h at 4 °C. Then protein A/G PLUS-Agarose was added and incubated for 1 h at 4 °C. After washing with RIP buffer three times, the complexes were incubated with 0.5 mg/ml proteinase K at 55 °C for 15 min. Trizol (Life Technologies) was added to extract the RNA. Reverse transcription was carried out and real-time PCR was performed using the following specific primers for PI3K-p110β: 5 ′-GATTATGTTGAACTTATTATTC-3′ (forward) and 5 ′-ATATTATATTTGCCCCACCAAT-3′ (reverse). The level of β-actin mRNA in each immunoprecipitation sample was used to normalize to the RIP results.

RAW 264.7 cells (1 × 10⁷) were stimulated with LPS for 6 h and harvested and re-suspended in 1.28 M sucrose, 40 mM Tris–HCl at pH 7.5, 20 mM MgCl₂, and 4% Triton X-100 for 20 min on ice. Cells were centrifuged at 2,500 × g for 15 min and the cell pellet was lysed in RIP buffer (150 mM KCl, 25 mM Tris at pH 7.4, 5 mM EDTA, 0.5 mM DTT, 0.5% NP40) and centrifuged at 13,000 rpm for 10 min. Then the rabbit anti-QKI antibody (Bethyl Laboratories) or rabbit IgG (Bethyl Laboratories) was added to the supernatants and incubated for 2 h at 4°C. The protein A/G PLUS-Agarose was added and incubated for 1 h at 4°C. After washing with RIP buffer three times, the complexes were incubated with 0.5 mg/ml proteinase K at 55°C for 15 min. Trizol (Life Technologies) was added to extract the RNA. Reverse transcription was carried out and real-time PCR was performed using the following specific primers for Ahr: AACTTCAGCAGGAAAAACAGGG (forward) and ATTTACTTTAACTTCTGGGACAA (reverse). The level of β-actin mRNA in each immunoprecipitation sample was used to normalize to the RIP results.