The largest database of trusted experimental protocols

Rabbit anti flag

Manufactured by Cell Signaling Technology
Sourced in United States, Japan

Rabbit anti-Flag is an affinity-purified polyclonal antibody raised in rabbits against the Flag epitope (DYKDDDDK). It is designed for the detection of proteins tagged with the Flag epitope.

Automatically generated - may contain errors

59 protocols using rabbit anti flag

1

Immunofluorescent Staining and Confocal Imaging

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells were fixed 24h after transfection in 4% formaldehyde in PBS and stained according standard protocols (including methanol fixation and permeabilization by PBS-T 0.04%). Following antibodies were used: anti-FLAG (F3165, Sigma), rabbit anti-FLAG (#2368S, Cell Signaling), mouse anti-G3BP1 (Ab56574, Abcam), rabbit anti-DDX6 (Ab40684, Abcam), rabbit anti-YB1 (Ab76149, Abcam), rabbit anti-TDP-43 (12892-1-AP, Proteintech), mouse anti-ataxin-2 (611378, BD Biosciences), goat anti-TIA1 (sc-1751, Santa Cruz). AlexaFluor 555 and AlexaFluor 488 secondary antibodies (Life Technologies) were used. Nuclei were visualized using NucBlue counterstaining (Thermo Scientific). Slides were mounted using ProLong Gold antifade reagent (Life Technologies).
Confocal images were obtained using a Zeiss LSM 510 Meta NLO confocal microscope. Images were analyzed, formatted and quantified with FIJI and ImageJ software. Statistics were carried out using Prism software.
Control stress granules were induced by incubating the cells for 1h with 0.5mM NaAsO2 (Sigma).
+ Open protocol
+ Expand
2

Plasmid Construction and Validation

Check if the same lab product or an alternative is used in the 5 most similar protocols
All the fragments were ligated into pcDNA3.1(+) plasmid, and the constructed plasmids were then verified by DNA sequencing. The pCre-luc (Santa Cruz, CA, USA) was kindly gifted by Xin Xie’s Lab of Tongji University. Human α-melanocyte stimulating hormone (α-MSH) and human adrenocorticotropin ACTH (1–24) was synthesized by Genescript (Nanjing, China). We purchased the paraformaldehyde (4%), phosphate buffered saline (PBS), bovine serum albumin, non-fat milk powder and β-mercaptoethanol from Sangon Biotech (Shanghai, China). TRNzol Universal Reagent and FastQuant RT Kit (with gDNase) were obtained from Tiangen Biotech (Beijing, China). Tetramethylbenzidine (TMB) chromogen solution was purchased from Beyotime® Biotechnology (Shanghai, China). Hydrochloric acid and sulfuric acid were obtained from Sinopharm Chemical Reagent Co., Ltd (Beijing, China). The antibodies used in this study included Rabbit anti-Flag (Cell Signaling Technology, USA), Mouse anti-HA (Sigma Aldrich, MO, USA), Mouse anti-Flag (Abcam, Cambridge, UK), Goat anti-Mouse IgG (horseradish peroxidase (HRP)-conjugated) (ABclonal Biotech Co., Ltd, Wuhan, China), and Goat Anti-Rabbit Alexa-Fluor 594 (Abcam). All primers used for full-length gene amplification, reverse transcription PCR (RT-PCR), and real-time quantitative PCR are listed in Supplemental Table 1 and synthesized by GENEWIZ (Suzhou, China).
+ Open protocol
+ Expand
3

Subcellular Localization of SLC25A51/52

Check if the same lab product or an alternative is used in the 5 most similar protocols
Approximately thirty hours following transient transfected of either pCMV-Flag-HA-SLC25A51 or pCMV-Flag-HA-SLC25A52, HeLa cells seeded on coverslips were fixed using 4% paraformaldehyde (Electron Microscopy Sciences #15710)/PBS for 15 minutes at room temperature. Fixed cells were then washed in PBS, blocked, and permeabilized for 1 hour at room temperature in 5% normal goat serum/0.3% Triton X-100/PBS. Primary antibodies were diluted and incubated with cells overnight at 4ºC in 1% BSA/0.3% Triton X-100/PBS. Rabbit anti-Flag (Cell Signaling Technologies #14793, 1:500); mouse anti-MTC02 (Abcam ab79479, 1:40). After washing, secondary antibodies were similarly diluted and incubated with cells for 1 hour at room temperature. Goat anti-Mouse IgG - Alexa Fluor 488 (Invitrogen A-11001, 1:1000); Goat anti-Rabbit IgG - Alexa Fluor 568 (Invitrogen A-11036, 1:1000). Following 3X PBS washes, cells were mounted with Vectashield Hardset w/ DAPI (Vector Labs, H-100). 0.11 μm optical slices were imaged using a Yokogawa W2 spinning disk confocal setup that includes 100mW 488 nm and 565 nm lasers, a 100X Olympus objective, and a Photonics Prime 95B sCMOS camera.
+ Open protocol
+ Expand
4

Antibody-Based Cytoskeletal Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
The following primary and secondary antibodies were used in this study. Rabbit anti-cofilin, rabbit anti-acetylated lysine, rabbit anti-flag, rabbit anti-CTTN, rabbit anti-phospho CTTN (Tyr421), rabbit anti-mouse IgG, (Cell Signaling), Rabbit anti-cofilin (Santa Cruz), Rabbit anti-cofilin, rabbit anti-phosphoSer3cofilin, rabbit-anti EB1, mouse anti-alpha tubulin (Abcam), mouse anti actin (Millipore), goat anti-mouse and anti-rabbit IgG HRP conjugate (Promega) and mouse TrueBlot Ultra Ig HRP (eBioscience). Rhodamine phalloidin was from Invitrogen. Reagents used include nocodazole, taxol (Sigma), trichostatin A (TSA; Calbiochem) and tubacin (provided by Ralph Mazitschek and Stuart Schreiber). Minimum essential medium-alpha modification (α-MEM), Dulbecco’s modified Eagle’s medium (DMEM) and fetal bovine serum (FBS) were purchased from Invitrogen (Carlsbad, CA).
+ Open protocol
+ Expand
5

Mapping ETV7 Chromatin Interactions

Check if the same lab product or an alternative is used in the 5 most similar protocols
293T cells were transfected with a FLAG-tagged ETV7-expressing plasmid, ETV7(FLAG), 48 h before treatment with IFN-α2 (100 U/mL, 9 h). Chromatin immunoprecipitation was performed using the ChIP-IT Express Enzymatic kit according to the manufacturer’s directions (Active Motif). DNA was enzymatically sheared for 10 min. ChIP antibodies included mouse IgG (Active Motif), rabbit anti-FLAG (Cell Signaling, 14793S), and mouse anti-FLAG (Sigma, F3165). Quantitative PCR was performed using SYBR Green (Bio-Rad) and primers targeting the Chr12 gene desert (Active Motif) or IFI44L promoter (forward primer, 5’ TTTCATGCCTGCCTACATAC 3’; reverse primer, 5’ ATGCCAACTGCCACTAAC 3’) in a region containing two potential ISRE sequences overlapping with ETS sites and analyzed using the ChIP-IT qPCR Analysis kit (Active Motif).
+ Open protocol
+ Expand
6

Antibodies Used in DNA Damage Assays

Check if the same lab product or an alternative is used in the 5 most similar protocols
We employed the following antibodies: rabbit anti-53BP1 (A300-273A, Bethyl), mouse anti-γ-H2AX (clone JBW301, Millipore), mouse anti-53BP1 (#612523, BD Biosciences), rabbit anti-GST (sc-459, Santa Cruz), a mouse anti-HA (F-7, sc-7392, SantaCruz or clone 12CA5, gift from M. Tyers, University of Montréal), mouse anti-MBP (E8032S, NEB), mouse anti-Flag (clone M2, Sigma), rabbit anti-Flag (#2368, Cell Signaling), mouse anti-tubulin (clone DM1A, Calbiochem), mouse anti-p53 (sc-126, Santa Cruz), rabbit anti-ubiquitin (Z0458, DAKO), rabbit anti-BRCA1 (#07-434, Millipore or home-made antibody7 (link)). Goat anti-GFP (gift from L. Pelletier, Lunenfeld-Tanenbaum Research Institute), HRP-conjugated AffiniPure goat anti-rabbit IgG (Jackson ImmunoResearch), HRP-linked sheep anti-mouse IgG (NA931, GE Healthcare). Alexa Fluor 488 goat anti-mouse and anti-rabbit IgG, Alexa Fluor 555 goat anti-mouse and anti-rabbit (MolecularProbes).
+ Open protocol
+ Expand
7

Co-immunoprecipitation of Protein Complexes

Check if the same lab product or an alternative is used in the 5 most similar protocols
HEK293 cells transiently transfected with indicated plasmids and harvested using ice-cold IP Lysis/Wash Buffer (Thermo-Fisher) including 20 mM N-ethylmaleimide and protease inhibitor cocktail. Protein concentrations were determined in a Direct Detect Spectrometer (Merck Millipore). Co-immunoprecipitation (Co-IP) was performed using a V5-antibody (Thermo-Fisher; #R960-25) and the Pierce Co-IP kit (Thermo-Fisher). Samples were analyzed by SDS-PAGE and immunoblotting with mouse anti-V5 (Thermo-Fisher), rabbit anti-HA (Cell Signaling; #3724), rabbit anti-Flag (Cell Signaling; #2368) and horseradish peroxidase (HRP)-linked secondary antibodies.
+ Open protocol
+ Expand
8

Antibody Validation for Toxoplasma Research

Check if the same lab product or an alternative is used in the 5 most similar protocols
The following primary antibodies were used in the immunofluorescence, immunoblotting and/or ChIP assays: rabbit home-made anti-BCLA, rabbit anti-TgHDAC3 (RRID: AB_2713903), rabbit anti-H4K31ac (RRID: AB_2811024), rabbit anti-H4K31me1 (RRID: AB_2811025), rabbit anti-TgGAP45 (gift from Pr. Dominique Soldati, University of Geneva), rat anti-CC2 (gift from W. Bohne and U. Gross), mouse anti-TgBAG1, mouse anti-G1/19 (gift from Pr. Gereon Schares, Friedrich-Loeffler-Institut), mouse anti-HA tag (Roche, RRID: AB_2314622), rabbit anti-HA Tag (Cell Signaling Technology, RRID: AB_1549585), rabbit anti-mCherry (Cell Signaling Technology, RRID: AB_2799246), rabbit anti-FLAG (Cell Signaling Technology, RRID: AB_2798687), rabbit anti-H3K14ac (Diagenode, RRID:AB_2713906), H3K9me3 (Millipore, RRID:AB_916348), H3K4me3 (Diagenode, RRID:AB_2616052), rabbit Anti-acetyl-Histone H4, pan (Lys 5,8,12) (Millipore, RRID:AB_310270). Immunofluorescence secondary antibodies were coupled with Alexa Fluor 488 or Alexa Fluor 594 (Thermo Fisher Scientific). Secondary antibodies used in Western blotting were conjugated to alkaline phosphatase (Promega) or horseradish peroxidase.
+ Open protocol
+ Expand
9

Immunofluorescence analysis of hMSH3 expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Twenty-five thousands cells per well were seeded onto 8-chamber slides (Invitrogen) and incubated at 37°C/5% CO2 overnight, followed by serum-starvation for 24 hrs before IL-6 treatment (1 ng/ml; R & D System; Minneapolis, MN) for 16–18 hrs at 37°C/5% CO2. Cells were briefly washed with PBS, fixed in cold acetone on ice for 5 min, air dried, and stored at 4°C until staining. For staining, cells were re-hydrated/blocked in 5% FBS/PBS at RT for 20 min before incubating with mouse anti-hMSH3 antibody (1:50; BD Biosciences; San Jose, CA) and/or rabbit anti-FLAG (1:500; Cell Signaling, Boston, MA) in 1% FBS/PBS at RT for 1–2 hr. After washing 3 times with 1% FBS/PBS (10 min each wash), cells were incubated with Alexa 488 conjugated anti-mouse and/or Alexa 589 conjugated anti-rabbit antibodies (Invitrogen; 1:1000) at RT for 1.5 hr. Cells were washed as described above and mounted with Prolong Gold with DAPI (Invitrogen). Pictures were taken using an Olympus fluorescent microscope.
+ Open protocol
+ Expand
10

Immunofluorescence Staining of Transfected Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells were transfected with plasmids containing MondoA-V5 and FLAG-Mlx using Lipofectamine 2000 (Thermo Fisher). Following protein synthesis inhibitor treatment, cells were fixed on glass coverslips using ice-cold 100% methanol for 15 min and stained using standard immunofluorescence procedures. Mouse anti-V5 (Thermo Fisher) antibody was used at 1:2000; rabbit anti-FLAG (Cell Signaling) antibody was used at 1:2000.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!