The genomic regions flanking the proximal and distal 3.7 kb deletions were amplified and Sanger sequenced using DNA extracted from whole blood samples obtained from the proband, mother, and father. PCR was performed using M13‐tailed primers (Table S1), Premix D (Lucigen), and AccuStart II Taq DNA Polymerase (Quantabio). Long‐range PCR was performed using AccuStart Long‐Range SuperMix (Quantabio). Bidirectional Sanger DNA sequencing was performed with BigDye Terminator Cycle Sequencing Kit (Life Technologies, Thermo Fisher Scientific) and M13 primers (IDT) and products were electrophoresed on an Applied Biosystems 3730 DNA Analyzer. Data analysis was performed using QIAxcel Advanced System (Qiagen), Sequence Scanner Software (Life Technologies, Thermo Fisher Scientific), and NCBI Blast.
Sequence scanner software
Manufactured by Thermo Fisher Scientific
Sourced in United States
Sequence Scanner software is a tool designed to analyze and visualize DNA sequence data. It provides a user-friendly interface for processing and interpreting sequencing results, enabling researchers to efficiently manage and interpret their genomic data.
Automatically generated - may contain errors
Lab products found in correlation
Ez dna methylation kit, by Zymo Research (2 mentions)
Dneasy blood tissue kit, by Qiagen (2 mentions)
Bigdye terminator cycle sequencing kit, by Thermo Fisher Scientific (1 mentions)
Qiaxcel advanced system, by Qiagen (1 mentions)
Accustart long range supermix, by Quantabio (1 mentions)
M13 primers, by Thermo Fisher Scientific (1 mentions)
Accustart 2 taq dna polymerase, by Quantabio (1 mentions)
Dyenamic et dye terminator cycle sequencing kit, by GE Healthcare (1 mentions)
Gel extraction kit, by Qiagen (1 mentions)
Superscript 4 reverse transcriptase, by Thermo Fisher Scientific (1 mentions)
Collagenase, by Roche (1 mentions)
Hanks b medium, by Roche (1 mentions)
Seqscape software, by Thermo Fisher Scientific (1 mentions)
Mutation surveyor software, by SoftGenetics (1 mentions)
Purelink quick plasmid miniprep kit, by Thermo Fisher Scientific (1 mentions)
Mircury lna universal rt microrna pcr, by Qiagen (1 mentions)
Abi 3730 genetic analyzer, by Thermo Fisher Scientific (1 mentions)
Gotaq master mix, by Promega (1 mentions)
Platinum taq dna polymerase, by Thermo Fisher Scientific (1 mentions)
Qiaquick pcr purification kit, by Qiagen (1 mentions)
15 protocols using sequence scanner software
1
Genomic Flanking Region Sequencing
2
Validation of A. caninum PCR Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After the synthesis of the controls and the selection of primers, the technique was validated by use of 75 DNA samples from A. caninum. A first PCR amplification with primers Fa and Ra was performed for each sample, after which a second reaction was carried out using the selected primers Fs4 + Rc and Fa + Rr4. These samples also were subjected to sequencing. Thus, the product of the first reaction with primers Fa and Ra was used for a second reaction in a final volume of 25 μL, applying the same conditions described for the control syntheses, with a 0.2 µM concentration of the Fa and Rc primers. The PCR products were subsequently purified, quantified, and sequenced. Sequencing was performed according to the method originally described by Sanger et al. (1977) . All sequencing reactions were carried out using the DYEnamic ET dye terminator cycle sequencing kit (GE Healthcare), and the runs were performed using the MegaBACE Long Read Matrix (GE Healthcare) with the same primers as in the second reaction. Chromatograms were analyzed using the Sequence Scanner software (Life Technologies, Carlsbad, CA, USA).
3
Validating Candidate Variations in Geese
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genotypes of candidate variations were validated in another 62 individuals representing three Chinese indigenous breeds, Zhedong goose, Panshi grey goose, and Yongkang grey goose, and the swan goose. Target variations were amplified using PCR as follows: 5 min at 95 °C; 35 cycles of 95 °C for 30 s, 55 °C for 30 s and 72 °C for 40 s; and a final extension at 72 °C for 5 min. Primers used in the PCR are listed in Table S2 . The anticipated PCR bands were purified using a Gel Extraction Kit (Qiagen, Hilden, Germany), and sequenced in 3730XL (Applied Biosystems, Foster City, CA, USA). Finally, results were analyzed using Sequence Scanner software (Applied Biosystems, Foster City, CA, USA).
4
Assessing Allelic Imbalance via Sanger Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Relative expression of the variant carrier and the normal allele was tested with Sanger sequencing. The ratio of electropherograms of the variant position on the cDNA template relative to the gDNA template was calculated. Briefly, cDNA was generated from 500 ng RNA using SuperScript™ IV Reverse Transcriptase (Thermo Fisher Scientific). cDNA primers were designed using Primer3Plus software (https//:primer3plus.com ): B2-C-e24_For—GATCCAGACTTTCAGCCATCTT and Rd_B2_Ex27.01_Rev—CGTCGTTTCAGTCTGAGATAATCT. Following PCR amplification and Sanger sequencing, data were visualized in Sequence Scanner software (Applied Biosystems, Thermo Fisher Scientific), and the peak ratio of the heterozygote position was given and compared to the peak ratio of the gDNA sequence of the same position for the same sample. The relative ratio was calculated and allelic imbalance was declared if the difference was >50%.
5
Phylogenetic Analysis of Yeast ITS Sequences
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quality of raw ITS region from yeast isolates and PCR-DGGE band sequencing data was checked with the help of Sequence Scanner software (Applied Bio systems, United States) and the data alignment and analysis were done with the help of SEQMANN software (DNASTAR, United States). After the data alignment, BLAST program was used for comparing DNA databases for sequence similarities available on the server3 (Altschul et al., 1990 (link); Zhao and Chu, 2014 (link)). Construction of a phylogenetic tree by the neighbor-joining method (Saitou and Nei, 1987 (link)) was performed using the CLUSTAL W program (Thompson et al., 1994 (link)). Shannon index of general diversity (H) and the richness of the microbial community as microbial diversity indices were determined by following the method of Oguntoyinbo et al. (2011) (link). Other graphical emphasis was done on igraph package in R Software (Csardi and Nepusz, 2006 ).
6
Quantifying ITPR3 Promoter Methylation
7
Bioinformatics Analysis of SsSir2 Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The nucleotide sequences were analyzed using Sequence Scanner software (Applied Biosystems/Life Technologies Corp., Carlsbad, CA, USA) and the BLAST network service of the National Center for Biotechnology Information (NCBI) (http://www.ncbi.nlm.nih.gov/blast ). The open reading frame was found by the ORF Finder (http://www.ncbi.nlm.nih.gov/gorf/gorf.html ). For the exact localization of the exon/intron boundaries the mRNA-to-genomic alignment program, Spidey (http://www.ncbi.nlm.nih.gov/IEB/Research/Ostell/Spidey/index.html ), was used. The deduced amino acid sequence was analyzed with the Expert Protein Analysis System (http://www.expasy.org/ ) and the protein domain characteristics of SsSir2 were determined using the Simple Modular Architecture Research Tool (http://hits.isb-sib.ch/cgi-bin/PFSCAN ). Isoelectric point and molecular weight prediction were carried out at (http://cn.expasy.org/tools/pi_tool.html ). Multiple alignments of SsSir2 were performed with the ClustalW Multiple Alignment Program (http://www.ebi.ac.uk/clustalw/ ).
8
Hepatocyte Isolation and DNA Methylation Analysis
9
Mutation Screening and Annotation of RB1 Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Sequencing results were visualized using Sequence Scanner Software (Applied Biosystems) to check for the data quality before further processing. Sequencing readouts that passed the initial QC step were assembled and compared to the RB1 reference gene sequence (GenBank Accession: L11910 ) using SeqScape Software (Applied Biosystems). Visual inspection of the alignment was done to identify the DNA variants in the RB1 gene of the patients for downstream analysis. In instances in which a possible small insertion or deletion was identified, Mutation Surveyor Software (Softgenetics, State College, PA) was used to deconvolute the overlapping signals to reveal the indel events. All variants identified as either single nucleotide variants (SNVs) or indels were reported according to the standard nomenclature for DNA sequence changes described by the Human Genome Variation Society (HVGS).
All variants identified were annotated against publicly available databases such as the Human Gene Mutation Database (HGMD ) and RB1 Locus-Specific Databases (RB1-LSDB ). The pathogenicity of the DNA sequence alterations were evaluated by using MutationTaster2 softwar e. All RB1 mutations found were submitted to RB1-LSDB.
All variants identified were annotated against publicly available databases such as the Human Gene Mutation Database (
10
Variant Analysis of Sequencing Data
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The quality of sequencing was checked through assessing the obtained chromatogram by Sequence Scanner software, version 1.0 (http://www.appliedbiosystems.com ). The data were then analyzed by Mutation Surveyor software, version 3.03 (www.softgenetics.com/mutationSurveyor.html ), for variation calling purposes. Pathogenesis potentiality of unclassified variants was investigated by Sift, Provean [17] (link), and PolyPhen-2 [18] (link) software. Segregation analysis was performed by sequencing all the family members for the responsible mutation.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!