One to three million cells were washed in PBS and total RNA was isolated with TRIzol reagent (ThermoFisher). cDNA was generated using the All-in-One cDNA Synthesis SuperMix according to manufacturer’s instructions (Bimake). Quantitative PCR was carried out on an Applied Biosystems machine (Thermo-Fisher) using SYBR Green qPCR Master Mix (Biotool). Relative transcript levels were calculated using Hprt or Actin as control. To compare gene expression levels between conditions, results are presented as the ratio of the expression of each gene relative to the control expression. Where indicated, results were expressed as a fold change relative to the control. Quantitative analysis was performed according to Pfaffl’s method [118 (link)]. Primer sequences are detailed in S1 Table .
All in one cdna synthesis supermix
Manufactured by Selleck Chemicals
Sourced in United States, China
The All-in-One cDNA Synthesis SuperMix is a convenient, ready-to-use solution for the reverse transcription of RNA into cDNA. It contains all the necessary components, including reverse transcriptase, RNase inhibitor, and dNTPs, in a single tube for a streamlined cDNA synthesis process.
Automatically generated - may contain errors
Lab products found in correlation
Sybr green qpcr master mix, by Selleck Chemicals (24 mentions)
Trizol reagent, by Thermo Fisher Scientific (10 mentions)
Rneasy mini kit, by Qiagen (6 mentions)
Total rna extraction kit, by Solarbio (5 mentions)
Trizol, by Thermo Fisher Scientific (5 mentions)
Turbo dnase, by Thermo Fisher Scientific (4 mentions)
Lightcycler 480 real time pcr system, by Roche (4 mentions)
Trizol reagent, by Takara Bio (4 mentions)
Dna clean concentrator 5, by Zymo Research (3 mentions)
Sybr green supermix, by Selleck Chemicals (3 mentions)
Sybr green, by Selleck Chemicals (3 mentions)
Trizol, by Merck Group (2 mentions)
Chamq universal sybr qpcr master mix, by Vazyme (2 mentions)
Sybr green qpcr master mix low rox, by Selleck Chemicals (2 mentions)
Dnase, by Promega (2 mentions)
Trizol reagent, by Tiangen Biotech (2 mentions)
Hipure total rna mini kit, by Magen Biotechnology Co (2 mentions)
Cfx connect real time pcr detection system, by Bio-Rad (2 mentions)
4 6 diamidino 2 phenylindole (dapi), by Beyotime (2 mentions)
Cfx manager 3.1 system, by Bio-Rad (2 mentions)
57 protocols using all in one cdna synthesis supermix
1
Quantitative Gene Expression Analysis
2
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using the High Purity Total RNA Rapid Extraction Kit (BioTeke, Beijing, China) according to the manufacturer's instructions, and the absorbances of the extracted RNAs at 260 nm and 280 nm were determined spectrophotometrically (Molecular Devices, Ramsey MN USA). RNA samples with purity ratios (A260/A280) between 1.8 and 2.0 were used for synthesizing single-strand cDNA by means of All-in-One cDNA Synthesis SuperMix (Bimake) for quantitative real-time polymerase chain reaction (qPCR). Gene-specific primers (Table 1 ) were designed by Invitrogen (Carlsbad, CA, USA). qPCR was performed to detect the relative mRNA expression levels using 2 ×SYBR Green qPCR Master Mix (Bimake) as described in the protocol. To determine the specificity of the amplification, melting curve analysis was performed for all final PCR products. Relative changes in gene expression were calculated and expressed as fold changes using the relative quantification (ΔΔCt) method. The relative abundance of each transcript was normalized to that of β-actin. Each sample was run in triplicate.
3
RNA Extraction and Quantification Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Extracted RNAs were treated with Turbo DNase (Thermo Fisher, Waltham, MA, USA) for 20 mins at 37°C, and were then size-selected to isolate RNA > 200 nt (DNA Clean & Concentrator™-5, Zymo Research) before reverse transcription using All-in-One cDNA Synthesis SuperMix (Bimake, Houston, TX, USA). Quantitative PCR (qPCR) was performed using the ABI Real-Time PCR Detection System with SYBR Green qPCR Master Mix (Bimake). Data were analyzed using DART-PCR58 (link). Spike-in RNA was used to normalize RNAs in different fractions. Supplementary Table 1 lists the qPCR primers. At least three biological replicates were used in each sample, and Student’s t test was applied for statistical analysis.
4
Quantifying Gene Expression by qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using TRIzol, and 1 μg of RNA was reverse-transcribed using All-in-One cDNA Synthesis SuperMix (Bimake). The relative mRNA expression was calculated by SYBR Green-based quantitative real-time PCR (qRT-PCR) technique using SYBR Green SuperMix (Bimake) in an ABI ViiA 7 PCR System (Applied Biosystem) using Actin-β as the reference gene, in relation to the control samples. Specific primers for qRT-PCR are listed in Table 1 .
5
RNA Extraction and Quantification Protocol
6
Quantitative RT-PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cells and cardiac tissues using the TRIzol reagent (Invitrogen, USA), and reverse-transcribed into cDNA using All-in-One cDNA Synthesis SuperMix (Bimake, USA). Next, the cDNA was quantitatively amplified using 2x SYBR Green qPCR Master Mix (Bimake, USA). Real‐time PCR was conducted in triplicate using an Applied Biosystems 6Flex (ABI, USA). The sequences of the forward and reverse primers used for amplification are shown in Tbl. S2. The results were presented relative to the expression of the GAPDH gene by the Delta-Delta Ct method.
7
Extraction and Quantification of Total RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For the in vivo study, rats were sacrificed by decapitation and brain regions were rapidly dissected, treated with RNAlater (Invitrogen, Thermofisher Scientific, Waltham, MA, USA) and stored at –80 °C. Total RNA was extracted with the Aurum total RNA fatty and fibrous tissue kit (Bio-Rad, Hercules, CA, USA) and quantified by absorbance in a NanoDrop 2000c UV-Vis spectrophotometer (ThermoFisher Scientific). cDNA was synthesised with the iScript Advanced cDNA synthesis Kit (Bio-Rad) following manufacturer’s instructions. In the in vitro experiments, total RNA was extracted with the Total RNA Purification kit (NORGEN Biotek, Thorold, ON, Canada) and quantified by absorbance in a NanoDrop 2000c UV-Vis spectrophotometer (ThermoFisher Scientific). cDNA was synthesised with the All-in-One Cdna Synthesis SuperMix (Bimake, Houston, TX, USA) following manufacturer’s instructions.
8
Gene Expression Analysis by qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were subjected to RNA extraction with TRIzol (Sigma, USA). cDNA was synthesized from RNA samples (1 μg) with All-in-One cDNA Synthesis Supermix (Bimake, USA). For mRNA analysis, cDNA was analyzed using ChamQ Universal SYBR qPCR Master Mix (Vazyme, China) for quantification by qRT-PCR on an Applied Biosystems QuantStudio Dx instrument (ThermoFisher, USA). The oligonucleotides used for amplification were as follows: GAPDH Forward, 5′-GACAGTCAGCCGCATCTTCT-3′; Reverse, 5′-GCGCCCAATACGACCAAATC-3′; G3BP1 Forward, 5′-CTATCCTCGGTGCTGTGGTG-3′; Reverse, 5′-GGGGGAAAAGAGTCAAATATGTCC-3′; USP10 Forward, 5′-CCTGGGCCATGATCCCATTT-3′; Reverse, 5′-TCAAGACGGGACAGAATGGC-3′.
9
RNA Extraction and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA, USA), after which cDNA was synthesized with the All‐in‐One cDNA Synthesis SuperMix (Bimake, Houston, TX, USA) according to the manufacture's protocol. The PCR was performed according to the instructions of 2 × SYBR Green qPCR Master Mix (Bimake). Following initial denaturation at 95 °C for 15 min, the amplification conditions were as follows: 45 cycles of denaturation at 95 °C for 10 s, annealing at 60 °C for 30 s, and elongation at 72 °C for 20 s.
10
Quantification of Inflammatory Markers in Bone Tissue
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Lumbar vertebral bone tissue stored in − 80 °C refrigerator was ground into powder form with liquid nitrogen, and then, a portion was added to 1 mL of Trizol solution. The primary chondrocytes cultured in vitro were added to 500μLTrizol solution. Bone tissue RNA was extracted and reverse transcribed according to the operating instructions of RNeasy Mini Kit (QIAGEN) and All-in-One cDNA Synthesis SuperMix (Bimake). The qPCR assay was then performed with 2 × SYBR Green qPCR Master Mix (Low ROX) (Bimake) reagent. And β-actin was used as a control gene for quantitative analysis. The target gene primer sequences were as follows:
| Primer name | Primer sequences (5’ → 3’) |
|---|---|
| IL-1β Forward | GCAACTGTTCCTGAACTCAACT |
| IL-1β Reverse | ATCTTTTGGGGTCCGTCAACT |
| TNFα Forward | CCCTCACACTCAGATCATCTTCT |
| TNFα Reverse | GCTACGACGTGGGCTACAG |
| Mmp13 Forward | TTTGAGAACACGGGGAAGA |
| Mmp13 Reverse | ACTTTGTTGCCAATTCCAGG |
| Col2 Forward | TGGTCCTCT GGGCATCTCAGGC |
| Col2 Reverse | GGTGAACCTGCTGTTGCCCTCA |
| RELA Forward | AGGCTTCTGGGCCTTATGTG |
| RELA Reverse | TGCTTCTCTCGCCAGGAATAC |
| β-actin Forward | GGAGATTACTGCCCTGGCTCCTA |
| β-actin Reverse | GACTCATCGTACTCCTGCTTGCTG |
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!