Taqman pre designed snp genotyping assay

Manufactured by Thermo Fisher Scientific

Sourced in United States

TaqMan Pre-Designed SNP Genotyping Assays are a set of standardized, ready-to-use assays for single nucleotide polymorphism (SNP) genotyping. These assays provide a reliable and efficient method for detecting and analyzing specific genetic variants.

Automatically generated - may contain errors

Lab products found in correlation

Genelute mammalian genomic dna miniprep kit, by Merck Group (22 mentions) C1000 touch thermal cycler, by Bio-Rad (16 mentions) Sterile foam tipped applicator, by Puritan (5 mentions) Abi 7500 fast real time pcr system, by Thermo Fisher Scientific (4 mentions) 7300 real time pcr system, by Thermo Fisher Scientific (3 mentions) Masterpure genomic dna purification kit, by Illumina (3 mentions) Qiaamp dna blood midi kit, by Qiagen (3 mentions) Taqman genotyping master mix, by Thermo Fisher Scientific (3 mentions) Taqman probe, by Bio-Rad (3 mentions) Cfx connect real time pcr detection system, by Bio-Rad (3 mentions) Stepone, by Thermo Fisher Scientific (3 mentions) Qiaamp dna blood mini kit, by Qiagen (2 mentions) Qiaamp dna mini kit, by Qiagen (2 mentions) Stepone real time polymerase chain reaction rt pcr instrument, by Thermo Fisher Scientific (2 mentions) Human whole blood genomic dna extraction kit, by Qiagen (2 mentions) Taqman snp genotyping assay, by Thermo Fisher Scientific (2 mentions) High pure pcr template preparation kit, by Roche (2 mentions) Genomic micro ax swab gravity, by A&A Biotechnology (2 mentions) Cfx96 touch real time pcr detection system, by Bio-Rad (2 mentions) Maxwell 16, by Promega (1 mentions)

67 protocols using taqman pre designed snp genotyping assay

Genotyping SNP rs662 in Whole-Blood DNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Whole-blood DNA was extracted using a commercial column (Qiagen-QIAamp DNA Blood mini kit). Real-time polymerase chain reaction was used for genotyping of SNP rs662 (chromosome 7; Applied Biosystems, TaqMan Pre-Designed SNP Genotyping Assay). Multiplex polymerase chain reaction (more than one primer/probe pair per reaction), which allows genotyping of the two possible variants at the single SNP site in a target template sequence, was performed. In each assay, there were two fluorescent dye detectors (one for the wild type, and the other for the mutation). The allelic discrimination assay classified samples as homozygotes (samples with only allele 1 or 2) and heterozygotes (samples with both alleles). TaqMan® MGB probe for SNP rs662 (labeled with VIC® dye) was used: (20X)TAAACCCAAATACATCTCCCAGGAT[C/T]GTAAGTAGGGGTCAAGAAAATAGTG
Based on the Gln (for the Q allozyme) → Arg (for the R allozyme) substitution at residue 192, three genotypes are derived: QQ, QR and RR.

Seow D.C., Gao Q., Yap P., Gan J.M., Chionh H.L., Lim S.C., Feng L, & Ng T.P. (2016). Profile of the Paraoxonase 1 (PON1) Gene 192Q/R Polymorphism and Clinical Associations among Older Singaporean Chinese with Alzheimer's and Mixed Dementia. Dementia and Geriatric Cognitive Disorders EXTRA, 6(1), 43-54.

+ Open protocol

+ Expand

Genetic Polymorphism Analysis in Liver Transplantation

Check if the same lab product or an alternative is used in the 5 most similar protocols

The recipients’ genetic material for IFNL3 polymorphism testing was obtained from fragments of the patients’ own liver removed during transplantation and stored as paraffin-embedded blocks. The donors’ genetic material was obtained through time-zero biopsies preceding reperfusion and was stored as paraffin-embedded blocks.
DNA was isolated using the Maxwell^®16 (Promega GmbH, Germany) instrument for nucleic acid and protein isolation. The Maxwell^® 16 FFPE Tissue LEV DNA Purification Kit (Promega GmbH, Germany) was used. Nucleotide sequences within rs12979860 were determined using allele-specific probes and the Custom TaqMan^® SNP Genotyping Assay (Applied Biosystems, A Thermo Fisher Scientific Brand). Possible single-nucleotide polymorphisms (SNPs) C > T withinrs12979860 included CC, CT, and TT. IFNL3 rs8099917 G > T genotyping was performed using the TaqMan^® Pre-Designed SNP Genotyping Assay (Applied Biosystems, A Thermo Fisher Scientific Brand). Possible SNP variants included TT, GT, and GG.
IFNL3 rs12979860 genotyping was performed for 88% of the recipients and 96% of the donors as well as for 120 recipient–donor pairs. In the case of the rs8099917 polymorphism, successful genotyping was performed for 84% of the recipients and 96% of the donors as well as 115 recipient–donor pairs.

Wieczorek-Godlewska R., Płoski R., Perkowska-Ptasińska A., Tronina O., Sadowska A., Pacholczyk M., Lisik W, & Durlik M. (2017). The impact of the recipient and donor interferon lambda-3 polymorphism on the course of HCV infection following liver transplantation. Clinical and Experimental Hepatology, 3(3), 152-158.

+ Open protocol

+ Expand

CYBA Gene Polymorphism Genotyping

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNA was extracted from peripheral lymphocytes using the MasterPure genomic DNA purification kit (Epicentre Technologies, Madison, USA). The −930A>G polymorphism of the CYBA gene was genotyped using the TaqMan^® Pre-designed SNP Genotyping Assay (Applied Biosystems, Foster City, California, USA). The total volume of 20 μl of reaction mix included: 10 μl of TaqMan^® Genotyping Master Mix (Cat.# 4371355), 1 μl of probe (TaqMan^® Pre-designed SNP Genotyping Assay, Cat.# 4351376, C_11291925_10), 1 μl of DNA template (15 ng/μl) and 8 μl of deionized water. The probe was diluted with the TE buffer (1:1) before the reaction. The polymerase chain reaction amplification was performed according to the manufacturer’s specifications. Genotyping was performed using the 7300 real-time PCR system (Applied Biosystems).

Niemiec P., Nowak T., Iwanicki T., Krauze J., Gorczynska-Kosiorz S., Grzeszczak W., Ochalska-Tyka A, & Zak I. (2014). The −930A>G polymorphism of the CYBA gene is associated with premature coronary artery disease. A case–control study and gene–risk factors interactions. Molecular Biology Reports, 41(5), 3287-3294.

+ Open protocol

+ Expand

Genetic Profiling of Metabolic Disorders

Check if the same lab product or an alternative is used in the 5 most similar protocols

Blood samples obtained from the subjects were centrifuged at 1500 rpm for 10 min. The buffy coat layer was separated and transferred into a 1.5-mL centrifuge tube. Genomic DNA was extracted from the concentrated lymphocytes of the buffy coat using the QIAamp DNA Mini Kit (Qiagen, Hilden, German). The related genetic alleles such as NCAN, GCKR, LYPLAL1, PNPLA3, PPP1R3B, FDFT1, COL13A1, EFCAB4B, PZP, and TM6SF2 were genotyped using the TaqMan^® Predesigned SNP Genotyping Assay (Applied Biosystems, Foster City, CA, United States) on a step one real-time PCR instrument (Applied Biosystems). The total reaction volume for each well was 10 µL containing 5 µL universal mastermix (Applied Biosystems), 0.5 µL assay mix, 3.5 µL distilled water, and 1 mL genomic DNA. The plate was set up at 95 °C holding stage for 20 s, 45 cycles of 95 °C denaturation for 3 s and 60 °C annealing for 20 s and run on a fast reaction (40 min for each run). Negative controls were introduced for every run to ensure genotyping quality.
The pathologist, radiologist, and laboratory technologist, who performed the tests for hepatic steatosis and SNPs, were blinded to the patients’ participation in this study. The laboratory team performing and interpreting the SNP assay was blinded to the identity and grouping of the patients and samples.

Lee G.H., Phyo W.W., Loo W.M., Kwok R., Ahmed T., Shabbir A., So J., Koh C.J., Hartono J.L., Muthiah M., Lim K., Tan P.S., Lee Y.M., Lim S.G, & Dan Y.Y. (2020). Validation of genetic variants associated with metabolic dysfunction-associated fatty liver disease in an ethnic Chinese population. World Journal of Hepatology, 12(12), 1228-1238.

+ Open protocol

+ Expand

Genotyping of GSTP1 Polymorphism

Check if the same lab product or an alternative is used in the 5 most similar protocols

DNA was extracted from buccal cells using a GenElute Mammalian Genomic DNA Miniprep Kit (Sigma, Germany) according to the manufacturer's protocol. All samples were genotyped using an allelic discrimination assay on a StepOne Real-Time Polymerase Chain Reaction (RT-PCR) instrument (Applied Biosystems, USA) with TaqMan probes. To discriminate GSTP1 A and G alleles (rs1695), a TaqMan Pre-Designed SNP Genotyping Assay was used (Applied Biosystems, USA) (assay ID: C___3237198_20), including primers and fluorescently labelled (FAM and VIC) MGB probes to detect both alleles. All sample were analysed in duplicate, and there was 100% agreement in genotype detection between samples.

Zarebska A., Jastrzebski Z., Kaczmarczyk M., Ficek K., Maciejewska-Karlowska A., Sawczuk M., Leońska-Duniec A., Krol P., Cieszczyk P., Zmijewski P, & Eynon N. (2014). THE GSTP1 c.313A>G POLYMORPHISM MODULATES THE CARDIORESPIRATORY RESPONSE TO AEROBIC TRAINING. Biology of Sport, 31(4), 261-266.

+ Open protocol

+ Expand

Genomic DNA Extraction and VDR Genotyping

Check if the same lab product or an alternative is used in the 5 most similar protocols

The genomic DNA was extracted from 200 μL of peripheral blood using the QIAamp DNA Blood Mini Kit (Qiagen, Hilden, Germany) on a QIAcube robotic workstation (Qiagen), as per manufacturer's instructions. DNA quality and concentration were measured using a BioDrop spectrophotometer. The genotyping of VDR gene polymorphisms rs2228570, rs1544410 and rs731236 was performed with TaqMan Pre-designed SNP Genotyping Assay on an Applied Biosystems 7500 fast real-time PCR device as per manufacturer's instructions. The PCR conditions of the cycles were set at 95 °C for 10 min, followed by 45 cycles of denaturation at 95 °C for 15 s and annealing/extension at 60 °C for 1 min. The obtained results were analyzed with allelic discrimination analysis software present on the Applied Biosystems 7500 fast PCR instrument.

Raljević D., Peršić V., Markova-Car E., Cindrić L., Miškulin R., Žuvić M, & Kraljević Pavelić S. (2021). Study of vitamin D receptor gene polymorphisms in a cohort of myocardial infarction patients with coronary artery disease. BMC Cardiovascular Disorders, 21, 188.

+ Open protocol

+ Expand

Genotyping CYBA gene polymorphism

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNA was extracted using the MasterPure genomic DNA purification kit (Epicentre Technologies, Madison, USA). The CYBA gene ^∗49A>G polymorphism (rs7195830) was genotyped using the TaqMan® Predesigned SNP Genotyping Assay (Applied Biosystems, Foster City, USA). Primer-probe sets were designed and prepared by the manufacturer. 7300 Real-Time PCR System (Applied Biosystems, Foster City, USA) was used to genotyping the rs7195830 polymorphism. Correctness of the genotyping was verified by regenotyping 15% of the samples and the repeatability was 100%.

Nowak T., Niemiec P., Górczyńska-Kosiorz S., Balcerzyk A., Iwanicki T., Krauze J., Grzeszczak W., Ochalska-Tyka A., Iwanicka J, & Zak I. (2016). The CYBA Gene ⁎49A>G Polymorphism (rs7195830) Is Associated with Hypertension in Patients with Coronary Artery Disease. BioMed Research International, 2016, 1539671.

+ Open protocol

+ Expand

Genotyping of p73 Polymorphism

Check if the same lab product or an alternative is used in the 5 most similar protocols

Blood samples were collected from each participant and genomic DNA was extracted using the Human Whole Blood Genomic DNA Extraction Kit (Qiagen, Valencia, CA, USA). We analyzed samples for the p73 G4C14‐to‐A4T14 polymorphism using the TaqMan Pre‐Designed SNP Genotyping Assay (Applied Biosystems, Foster City, CA, USA) following the manufacturer’s instructions. The PCR primers used for amplifying p73 G4C14‐A4T14 were as follows: 5′‐CAGGAGGACAGAGCACGAGTT‐3′ (forward) and 5′‐TGATGAGGGTGGCTAAGGCTA‐3′ (reverse). Approximately 15% of the samples were randomly selected for repeat genotyping by a different investigator, and the results were entirely concordant.

Ge L., Yang Y., Sun Y., Xu W., Lu D, & Su B. (2017). P73 G4C14‐to‐A4T14 polymorphism is associated with survival in advanced non‐small cell lung cancer patients. Thoracic Cancer, 8(2), 63-72.

+ Open protocol

+ Expand

Genotyping of CYP7A1 rs7833904 SNP

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNA was isolated from leukocytes of peripheral blood using the MasterPure genomic DNA purification kit (Epicentre Technologies, Madison, USA). The rs7833904 polymorphism of the CYP7A1 gene was genotyped using the TaqMan Predesigned SNP Genotyping Assay (Applied Biosystems, Foster City, USA).
Total volume of 20 μL of reaction mix included 10 μL of TaqMan Genotyping Master Mix (Cat.# 4371355), 1 μL of probe (TaqMan Predesigned SNP Genotyping Assay, Cat.# 4351379; ID C_11309045_10), 1 μL of DNA template (15 ng/μL), and 8 μL of deionized water. Probe was diluted with the TE buffer (1 : 1) before the reaction. Polymerase chain reaction amplification was performed according to the manufacturer's specifications. Genotyping was performed using the 7300 Real-Time PCR System (Applied Biosystems). 30% of samples were regenotyped to exclude the genotyping errors. Repeatability of results was 100%.

Iwanicki T., Balcerzyk A., Niemiec P., Nowak T., Ochalska-Tyka A., Krauze J., Kosiorz-Gorczynska S., Grzeszczak W, & Zak I. (2015). CYP7A1 Gene Polymorphism Located in the 5′ Upstream Region Modifies the Risk of Coronary Artery Disease. Disease Markers, 2015, 185969.

+ Open protocol

+ Expand

Genotyping of DRD1 Polymorphism

Check if the same lab product or an alternative is used in the 5 most similar protocols

DNA extraction was carried out from 400 μL of peripheral blood using a salting out method [21 (link)] and DNA was normalized to 10 ng/μL. For the analysis of the functional polymorphism in the DRD1 gene (rs686), a TaqMan SNP genotyping assay (Applied Biosystems, Foster City, CA, USA, C_1011786_10) was used. It was carried out with 1X of TaqMan Genotyping Master Mix (Applied Biosystems), 1X of TaqMan Pre-Designed SNP Genotyping Assay (Applied Biosystems) and 20 ng of genomic DNA for a final volume of 10 μL. Fifty PCR cycles were run in a CFX96 Touch Real-Time PCR system (BioRad, Hercules, CA, USA) and the genotypes were analyzed using the CFX Manager software v.3.0 (BioRad).

Jiménez K.M., Pereira-Morales A.J, & Forero D.A. (2018). A Functional Polymorphism in the DRD1 Gene, That Modulates Its Regulation by miR-504, Is Associated with Depressive Symptoms. Psychiatry Investigation, 15(4), 402-406.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!