Innuprep virus dna rna kit

DNA of most samples were purified by using the DNeasy Blood & Tissue kit (Qiagen, Hilden, Germany). According to the results of pre-tests (data not shown here), a volume of 80 µL of fresh and frozen blood were used for the nucleic acid extraction and further processing was carried out according to the manufacturer's recommendations. For the nucleic acid extraction of the PBMC and BALF samples, 1 × 10⁶ cells were used. The DNA extraction of the organs (tonsils, heart, bone marrow) was based on 20 mg of each tissue. All samples were eluted in 200 µL elution buffer. In addition, two alternative methods of DNA isolation were performed: To confirm the negative results, a higher number of PBMCs (3 × 10⁶ cells) (modification 1, Supplementary Table 2) and the innuPREP Virus DNA/ RNA Kit (Analytik Jena, Jena, Germany) (modification 2) were used according to the manufacturer´s instructions. RNA/DNA from 3 × 10⁶ cells was eluated in 30 µL nuclease-free water. The samples were stored at − 20 °C until further processing.

Next-generation sequencing was used to obtain the consensus genomic sequences. The viral nucleic acid was extracted directly from 200 µL cell culture supernatants using the innuPREP Virus DNA/RNA Kit (Analytik Jena, Jena, Germany) according to the manufacturer’s instructions. The reversible terminator sequencing method was used to determine whole genome sequences as described elsewhere in detail [12 (link),13 (link)]. DNA libraries were sequenced on an Illumina^® NextSeq 500 sequencer (Illumina, San Diego, CA, USA). Sanger sequencing was carried out to confirm the structure of the tandem-repeat region bridging ORF19 and ORF8. The primer sequences used in PCR amplification and direct sequencing were as follows: 5′-CTCACAGTCTATTGCAGACTGC-3′ and 5′-CACTAGCCTTAGAGAAATGGTG-3′. Dye-labeled fragments were run on ABI 3500 equipment (Delta-Bio Ltd., Szeged, Hungary). Genome assemblies were carried out by combining the sequence files from NGS runs and capillary sequencing runs within the Geneious Prime^® 2022.2.2 software (Biomatters Ltd., Auckland, New Zealand). The obtained sequences were deposited in GenBank under the accession numbers OP985603 to OP985634.

To quantify genomic copies in oropharyngeal swabs and 25 mg homogenized lung tissue, RNA was extracted using innuPREP Virus DNA/RNA kit (Analytic Jena) according to the manufacturer’s instructions. qPCR was performed using the NEB Luna Universal Probe One-Step RT–qPCR kit (New England Biolabs) with cycling conditions of 10 min at 55 °C for reverse transcription, 3 min at 94 °C for activation of the enzyme, and 40 cycles of 15 s at 94 °C and 30 s at 58 °C on a qTower G3 cycler (Analytic Jena) in sealed qPCR 96-well plates. Primers and probes were used as previously reported⁵⁷ . Oligonucleotides (Sequence (5’-3’)): E_Sarbeco_F: ACAGGTACGTTAATAGTTAATAGCGT;
E_Sarbeco_R: ATATTGCAGCAGTACGCACACA;
E_Sarbeco_P1: FAM-ACACTAGCCATCCTTACTGCGCTTCG-BBQ.