Full-length ORFs of PdCLO2 and PdCLO4 genes (720 and 711 bp, respectively) were amplified by PCR using date palm cDNA. For further purification of recombinant proteins, primers were designed to add a His tag at the N-terminal ends of the PdCLO2 and PdCLO4 genes (Table S1 ). Purified PdCLO2 and PdCLO4-PCR products were ligated to pGEM-T Easy vector (Promega, USA) following the manufacturer's manual. The recombinant plasmids pGEM-T/PdCLO2 and pGEM-T/PdCLO4 were transferred into E. coli Top10 competent cells. Recombinant plasmids were extracted from E. coli Top10 using a plasmid purification mini kit (Qiagen, Germany). The presence of PdCLO2 and PdCLO4 genes in the isolated plasmid was confirmed by PCR and SacI-EcoRI digestion. At least three clones of both genes were sequenced on both strands using T7 and SP6 primers on an ABI 310 Genetic Analyser (Applied Biosystems) using Big Dye Terminator kit (Applied Biosystems). Nucleotide sequence analysis and multiple alignments of the nucleotide and deduced amino acid sequences were performed with Vector NTI advance (Invitrogen).
Abi 310 genetic analyser
Manufactured by Thermo Fisher Scientific
The ABI 310 Genetic Analyser is a capillary electrophoresis-based system designed for DNA sequencing and fragment analysis. It utilizes a single capillary to separate and detect fluorescently labeled DNA fragments. The instrument is capable of performing various applications, including DNA sequencing, microsatellite analysis, and SNP detection.
Automatically generated - may contain errors
Lab products found in correlation
Bigdye terminator kit, by Thermo Fisher Scientific (2 mentions)
Vector nti advance, by Thermo Fisher Scientific (1 mentions)
Plasmid purification mini kit, by Qiagen (1 mentions)
Pgem t easy vector, by Promega (1 mentions)
Dyeex 2.0 spin kit, by Qiagen (1 mentions)
Hidi formamid, by Thermo Fisher Scientific (1 mentions)
Bigdye terminator v3.1 cycle sequencing kit, by Thermo Fisher Scientific (1 mentions)
Pcr purification kit, by Qiagen (1 mentions)
Bigdye terminator v1.1 cycle sequencing kit, by Thermo Fisher Scientific (1 mentions)
Qiamp dna mini kit, by Qiagen (1 mentions)
Primer express 3, by Thermo Fisher Scientific (1 mentions)
Qiaquick pcr purification kit, by Qiagen (1 mentions)
Qiaamp dna ffpe tissue kit, by Qiagen (1 mentions)
Genescan 3.7 analysis software, by Thermo Fisher Scientific (1 mentions)
8 protocols using abi 310 genetic analyser
1
Cloning and Sequencing of Date Palm CLO Genes
2
Sequencing of PCR Products
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All the primers used for sequencing are listed in the Additional file 2 : Table S2. All PCR reaction conditions are specified in the Additional file 3 . The obtained products were purified using the PCR Purification Kit (Qiagen), as described in the manual. Sequencing reaction was performed using Big Dye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems). The sequencing products were purified using DyeEx 2.0 Spin Kit (Qiagen) according to the manufacturer’s instructions. The purified products were diluted with 18 μl HiDi-Formamid (Applied Biosystems), incubated at 95°C for 3 min and chilled on ice for 3 min. Sequencing was performed using ABI310 Genetic Analyser (Applied Biosystems), and data were collected using ABI Prism 310 Data Collection Software.
3
Bacterial Genomic DNA Extraction and 16S rRNA Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA extraction, 16S rRNA gene amplification and sequencing of PCR amplification fragments were performed according to Rameshkumar and Nair.24 (link) The purified PCR product was used directly for DNA sequencing, using the dideoxy chain termination method with Big Dye Terminator kit (Applied Biosystems). The reaction products were analysed using capillary electrophoresis on an ABI 310 Genetic Analyser (Applied Biosystems).
The sequences were compared with the GenBank nucleotide data library using the Blast software at the National Centre of Biotechnology Information website (http://www.ncbi.nlm.nih.gov ), in order to determine their closest phylogenetic relatives.
The partial 16S rDNA sequences of the isolates selected for cellulase and xylanase activity have been submitted to EMBL, and the accession numbers are reported in Table1 .
The sequences were compared with the GenBank nucleotide data library using the Blast software at the National Centre of Biotechnology Information website (
The partial 16S rDNA sequences of the isolates selected for cellulase and xylanase activity have been submitted to EMBL, and the accession numbers are reported in Table
4
DNA Sequencing Identification Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Species identification was achieved by sequencing the amplified products: they were purified with Exo-Sap (USB Europe, Staufen, Germany) treatment according to the manufacturer’s recommendations. Forward and reverse sequencing reactions were performed using ABI Prism BigDye Terminator Cycle Sequencing Ready Reaction Kit, version 1.1 (Applied Biosystems, Foster City, CA). Sequenced fragments were purified by DyeEX (Qiagen, Hilden, Germany) and resolved by capillary electrophoresis using an ABI 310 Genetic Analyser (Applied Biosystems, Foster City, CA). The nucleotide sequences were analyzed using the BLASTN sequence similarity search at the NCBI database (Altschul et al., 1990 (link)).
5
Candida Species Identification Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Before DNA isolation, cells were cultivated overnight on Sabouraud medium at 30°C and DNA was extracted according to [15 ]. Isolates presumptively identified as C. albicans were genotyped with the CAI species-specific microsatellite marker. CAI locus was amplified with primers 5´-ATG CCA TTG AGT GGA ATT GG-3´ (forward) and 5´-AGT GGC TTG TGT TGG GTT TT-3´ (reverse), according to [13 (link)]. PCR products were analysed by capillary electrophoresis in an ABI 310 genetic analyser (AB Applied Biosystems) and fragment sizes were determined automatically using the GeneScan 3.1 Analysis software. Alleles were designated according to the number of trinucleotide repeats [13 (link)].
Molecular identification of non-albicans isolates was performed by sequencing the internal transcribed spacer (ITS) regions of ribosomal RNA genes. Sequence analysis was carried out using primers ITS1 (5ʹ TCCGTAGGTGAACCTGCGG 3ʹ) and ITS4 (5ʹ TCCTCCGCTTATTGATATGC 3ʹ), according to [16 ], and PCR products purified using the commercial Kit GenElute® PCR Clean-up (SIGMA). Sequences were edited with the Sequencer version 4.9 software package (Genes Codes Corporation), aligned with MEGA-X software [17 ] and compared by BLAST with sequences available from NCBI GenBank and ISHAM-barcoding database.
Molecular identification of non-albicans isolates was performed by sequencing the internal transcribed spacer (ITS) regions of ribosomal RNA genes. Sequence analysis was carried out using primers ITS1 (5ʹ TCCGTAGGTGAACCTGCGG 3ʹ) and ITS4 (5ʹ TCCTCCGCTTATTGATATGC 3ʹ), according to [16 ], and PCR products purified using the commercial Kit GenElute® PCR Clean-up (SIGMA). Sequences were edited with the Sequencer version 4.9 software package (Genes Codes Corporation), aligned with MEGA-X software [17 ] and compared by BLAST with sequences available from NCBI GenBank and ISHAM-barcoding database.
6
Mutational Analysis of KIT and PDGFRA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mutational analyses of KIT (exons 11, 9, 13, 14 and 17) and PDGFRA (exons 12,14 and 18) were performed on genomic DNA extracted from paraffin-embedded tumour tissue through the commercial QiAamp DNA FFPE Tissue Kit (QIagen) using a combination of polymerase chain reaction (PCR) amplification and automated sequencing.
To exclude other KIT or PDGFRA mutations, PDGFRA gene exons 12, 14, and 18 and KIT gene exons 8, 9, 11, 13, 14, 17, and 18 were sequenced on freshly frozen tumour specimens by the Sanger sequencing method. DNA was isolated by the QIAmp DNA Mini kit (Qiagen, Milan, Italy) in accordance with the manufacturer’s directions. Each exon was amplified with PCR amplification using specific primer pairs designed with Primer Express 3.0 software (Applied Biosystem) to amplify specific exons. Then, the PCR products were purified with the Qiaquick PCR purification kit (Qiagen) and sequenced on both strands using the Big Dye Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems). Sanger sequencing was performed on an ABI 310 Genetic Analyser (Applied Biosystems).
To exclude other KIT or PDGFRA mutations, PDGFRA gene exons 12, 14, and 18 and KIT gene exons 8, 9, 11, 13, 14, 17, and 18 were sequenced on freshly frozen tumour specimens by the Sanger sequencing method. DNA was isolated by the QIAmp DNA Mini kit (Qiagen, Milan, Italy) in accordance with the manufacturer’s directions. Each exon was amplified with PCR amplification using specific primer pairs designed with Primer Express 3.0 software (Applied Biosystem) to amplify specific exons. Then, the PCR products were purified with the Qiaquick PCR purification kit (Qiagen) and sequenced on both strands using the Big Dye Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems). Sanger sequencing was performed on an ABI 310 Genetic Analyser (Applied Biosystems).
7
Fungal Identification via ITS Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Isolates that presented distinctive identification by the classical and new spectral phenotypic approaches were analysed by ITS sequencing. ITS region was chosen taking into consideration that this region is formally the primary fungal barcode marker recommended by the Consortium for the Barcode of Life (Schoch et al., 2012 (link)). Sequence analysis was carried out on the entire ribosomal ITS region (i.e., ITS1/58S rDNA/ITS2), according to White et al. (1990) . Sequencing was performed with an ABI 310 Genetic Analyser (Applied Biosystems) using standard protocols. Strains were identified at the level of 99.0% sequence similarity or higher after a NCBI blast.
8
Microsatellite Markers for C. parapsilosis Identification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Four C. parapsilosis-specific microsatellite markers were used, designated as CP1, CP4, CP6 and B, and PCR amplification was performed following the methodology developed and described previously [23] .
After PCR, denaturated samples were run in an ABI 310 Genetic Analyser (AB Applied Biosystems), the PCR product size was determined by the GeneScan 3.7 Analysis software and alleles were designated by their sizes in base pairs [23] .
After PCR, denaturated samples were run in an ABI 310 Genetic Analyser (AB Applied Biosystems), the PCR product size was determined by the GeneScan 3.7 Analysis software and alleles were designated by their sizes in base pairs [23] .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!