Real-time PCR was performed as previously described [56 (link)–58 (link)]. In brief, total RNA was isolated from tissues using Trizol and chloroform. The quantity and quality of the RNA were analyzed using a NanoDrop One Microvolume UV-Vis Spectrophotometer (Thermo Fisher Scientific, Shanghai, China). Total RNA (2 μg) was transcribed with an iScript cDNA synthesis kit (TaKaRa, Dalian, China). qPCR was performed using SYBR PCR master mix (Applied Biosystems/Thermo Fisher Scientific) and a QuantStudioTM 6 Flex Real-time PCR system (Thermo Fisher Scientific). The PCR conditions were 40 cycles of 5 sec denaturation at 95 °C, 30 sec annealing at 55 °C and 5 sec extension at 65 °C. Glyceraldehyde-3-phosphate dehydrogenase was measured as a comparative reference. The primer sequences for qPCR are listed in PubMed primer blast online (Table 1 ). The mRNA relative quantitation was calculated using the ΔΔCt method.
Iscript cdna synthesis kit
Manufactured by Takara Bio
Sourced in Japan, China
The IScript cDNA synthesis kit is a reagent used to convert RNA into complementary DNA (cDNA) in a reverse transcription reaction. The kit contains the necessary components, including a reverse transcriptase enzyme, to efficiently generate cDNA from RNA samples.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (8 mentions)
Trizol reagent, by Takara Bio (4 mentions)
Sybr primescript mirna rt pcr kit, by Takara Bio (3 mentions)
Cfx96 real time system, by Bio-Rad (2 mentions)
Rneasy total rna isolation kit, by Qiagen (2 mentions)
Iq sybr green supermix, by Bio-Rad (2 mentions)
Cfx96tm real time system, by Bio-Rad (2 mentions)
Sybr premix ex taq, by Takara Bio (2 mentions)
Rneasy kit, by Qiagen (2 mentions)
Real time system, by Thermo Fisher Scientific (2 mentions)
Rnaeasy kit, by Tiangen Biotech (2 mentions)
Rnaiso plus, by Takara Bio (2 mentions)
Rneasy mini purification kit, by Qiagen (2 mentions)
Sybr green premix ex taq, by Takara Bio (2 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (2 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (2 mentions)
Nanodrop one microvolume uv vis spectrophotometer, by Thermo Fisher Scientific (1 mentions)
Sybr pcr master mix, by Thermo Fisher Scientific (1 mentions)
Quantstudiotm 6 flex real time pcr system, by Thermo Fisher Scientific (1 mentions)
Mirvana qrt pcr mirna detection kit, by Thermo Fisher Scientific (1 mentions)
27 protocols using iscript cdna synthesis kit
1
Quantitative Real-Time PCR Protocol
2
Quantitative Analysis of Fibrosis Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total cellular RNA was extracted with Trizol reagent and reverse-transcribed into cDNA using the iScript cDNA synthesis kit (TaKaRa, Kyoto, Japan). Quantitative real-time PCR was performed using the SYBR green-based assay with CFX96 Real-Time system (Bio-rad, Hercules, CA, USA). The following primer sequences was used (shown 5’-3’): α-SMA sense, CTGTGCTATGTCGCTCTGGA; α-SMA anti-sense, ATAGGTGGTTTCGTGGATGC; Col1a1 sense, GGTCAGACCTGTGTGTTCCC; Col1a1 anti-sense, GGTCCATGTAGGCTACGCTG; TGF-β sense, GCTAATGGTGGACCGCAACAA; TGF-β anti-sense, CACTGCTTCCCGAATGTCTGA; PAI-1 sense, CCGAGAGCTTTGTGAAGGAG; and PAI-1anti-sense, ACATCTGCATCCTGGAGCTT.
3
Real-time PCR of miR-1 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Real-time PCR was conducted as described previously 38 . Total RNA of cells or heart tissues was harvested using a TRIzol Reagent (Thermo Fisher Scientific, Waltham, USA) and a RNeasy Total RNA Isolation Kit (Qiagen, Hilden, Germany). Isolated RNA was reverse-transcribed using an iScript cDNA Synthesis Kit (Takara BIO, Otsu, Japan). Real-time PCR was performed using iQ SYBR Green Supermix (Bio-Rad Laboratories, Hercules, CA) in the CFX96TM Real-Time System (Bio-Rad Laboratories, Hercules, CA). All primers were purchased from Sangon Biotech Corporation (Shanghai, China) and were presented in Table S2
4
RNA Extraction and Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TRIzol Reagent (Life Technologies, CA, United States) was used to isolate total RNA, which was used to synthesize complementary DNA with the iScript cDNA Synthesis Kit (Takara, Liaoning, China). Real-time PCR was subsequently performed using an SYBR premix Ex Taq (Takara) and the ABI 7500 Sequence Detection System (Thermo Fisher Scientific, MA, United States). All procedures were performed according to the manufacturer’s protocols.
5
Pituitary Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quantitative RT-PCR was carried out in accordance with a method previously described [9 ]. In brief, total RNA was extracted from pituitary with the RNeasy Kit (Qiagen, Canada). One microgram of total RNA was used for cDNA synthesis with the iScript cDNA Synthesis Kit (Takara, Japan). Quantitative RT-PCR reactions were performed in ABI PRISM 7500 Sequence Detection System (Applied Biosystems, Foster City, CA). β-actin was used as an internal satandard for normalization. Tshβ, Fshβ, Lhβ and Acth gene expressions were measured, and the relative expression fold change was calculated by using the 2−ΔΔCt method [41 (link)]. Primer sequences of targets are shown in Table 5 .
6
Quantifying Gene Expression via RT-qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from cells or tissues was extracted using TRIzol® reagent (Invitrogen, USA). Isolated RNA was reverse-transcribed and duplicated using PrimeScript™ RT Master Mix (Vazyme, Nanjing, China) and SYBR qPCR master mix (Vazyme, Nanjing, China) in iScript cDNA Synthesis Kit (Takara BIO, Otsu, Japan) and the Light-Cycler 480 Real-Time PCR System (Roche, San Francisco, CA, USA). Primers sequences are listed in Supplementary Table S1 . The results were normalized to GAPDH and expressed as percentage of controls.
7
Extraction and qPCR Analysis of RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using TRIzol (Life, USA) and the RNAeasy kit (Tiangen, China). The iScript cDNA Synthesis Kit (Takara, Japan) was used to synthesize the first strand of cDNA according to the RT-qPCR instructions. The cDNA samples were then subjected to PCR amplification with SYBR Green (Life, USA) in a reaction volume of 20 μL. The primers used are provided in Table 1 . The amplification was carried out in a real-time system (Applied Biosystems, USA) with an initial step of 10 min at 95°C, followed by denaturation at 94°C for 15 s, annealing at 54°C for 30 s, and extension at 72°C for 40 s.
8
Quantification of Viral Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Sf9 cells (1.0 × 106 cells/plate) were transfected in triplicate with bAcac75F54S-ph or bAcac75REP-ph bacmid DNA and collected at 24 h post-transfection (p.t.). Total cellular RNA was isolated by using RNAiso Plus (Takara). The cDNA was then synthesized using an iScript cDNA synthesis kit (Takara). qPCR was performed with five pairs of specific viral gene primers (sequences are shown in Table 1 ) by a CFX96 real-time system (Bio-Rad) under the following conditions: denaturation at 95°C for 3 min followed by 40 cycles of 95°C for 10 s, 55°C for 30 s and 72°C for 20 s. Melting curve analysis was performed at the end of each PCR assay to test specificity (control). Host 18S rRNA was selected and used as the endogenous reference.
9
RNA Extraction and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNAs were extracted with the TRIZOL (Life, USA) and RNAeasy kit (Tiangen, China). The first strand of cDNA was synthesized by iScript cDNA Synthesis kit (Takara, Japan) according to the instructions for qPCR. The mixed cDNA samples were used for PCR reaction with SYBR Green (Life, USA) in 20 mol/L volume. The primer used are listed s in Table 3 . The reaction was performed at 95°C for 10min, followed by denaturation at 94°C for 15 s, annealing at 54°C for 30 s and extension at 72°C for 40 s, with a Real‐Time System (Applied Biosystems, USA).
10
Evaluating MDR1 Gene Silencing Effects
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To evaluate effects of MDR1-siRNA on MDR1 gene expression, RT-qPCR assays were used. KBV cells from different transfection groups were used to extract total RNA using an RNeasy mini purification kit (Qiagen, Valencia, CA, USA), and cDNAs were synthesized using iScript™ cDNA synthesis kit (Takara Bio, Tokyo, Japan). Primers (MDR1 F: 5′-TGACTCAGGAGCAGAAGTTTGAACA-3′ and MDR1 R: 5′-AAATACATCATTGCCTGGGTGAAG-3′) were used to check MDR1 expression. Primers (β-actin F: 5′-TGGCACCCAGCACAATGAA-3′ and β-actin R: 5′-CT AAGTCATAGTCCGCCTAGAAGCA-3′) were used as internal control. The qPCR assays were performed using SYBR-Green Premix Ex Taq (Takara Bio) and MxPro M ×3005P real-time PCR detection system (Agilent Technologies, Santa Clara, CA, USA). All experiments were repeated three times.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!