The largest database of trusted experimental protocols

Revertra ace qpcr rt kit fsq 101

Manufactured by Toyobo
Sourced in Japan

The ReverTra Ace qPCR RT Kit FSQ-101 is a reverse transcription kit used for quantitative real-time PCR (qPCR) analysis. The kit includes reagents for reverse transcription and quantitative PCR in a single reaction.

Automatically generated - may contain errors

3 protocols using revertra ace qpcr rt kit fsq 101

1

Quantifying Macrophage Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from bronchoalveolar macrophages with a MiniBEST universal RNA Extraction Kit (9767, Takara, Shiga, Japan) according to the manufacturer’s instructions. The mRNA expression levels of TNF-α, iNOS, IL-10, and Arg-1 were measured by RT-PCR performed using a RT-PCR kit (ReverTra Ace qPCR RT Kit FSQ-101, Toyobo, Osaka, Japan) according to the manufacturer’s instructions. Gene-specific primers were designed to amplify these markers genes. The reference gene β-actin was used as an endogenous control. The primer sequences were as follows: TNF-α Forward: 5′CCCAGACCCTCACACTCAGATCAT-3′, Reverse: 5′-GCAGCCTTGTCCCTTGAAG-AGAA-3′; IL-10 Forward: 5′-CTTTCACTTGCCCTCATCC-3′, Reverse: 5′-ACAAAC-AATACGCCATTCCC-3′; iNOs Forward: 5′-ACATTCAGATCCCGAAACGC-3′, Reverse: 5′-ACAATCCACAACTCGCTCC-3′; Arg-1 Forward: 5′-GGGGAAAGCCAA-GAAG3′, Reverse: 5′TGGTTGTCAGGGGAGTGT-3′; β-actin Forward: 5′-TGGA-ATCCTGTGGCATCCATGAAAC-3′, Reverse: 5′-TAAAACGCAGCTCAGTAACAGT-CCG -3′. The relative mRNA expression levels of each gene was calculated and analyzed with Image J software (NIH, Bethesda, MD, USA).
+ Open protocol
+ Expand
2

Investigating Inflammatory Signaling Pathways

Check if the same lab product or an alternative is used in the 5 most similar protocols
The phosphatase inhibitor cocktail and protease inhibitor cocktail were purchased from Sigma-Aldrich (St. Louis, MO, USA). The following antibodies were used: Anti-cGAS (#15102), anti-TBK1 (#3504S), anti-phospho-TBK1 (#5483), anti-IRF3 (#4302), anti-phospho-IRF3 (#4947), anti-α-Smooth Muscle Actin (D4K9N) (#19245), anti-GAPDH (D16H11) (#5174), Horseradish peroxidase (HRP)-conjugated goat anti-rabbit or anti-mouse IgG (all from Cell Signaling Technology, Danvers, MA, USA). Anti-Collagen I (ab6308)) and anti-Collagen III (ab184993) were both purchased from Abcam (Cambridge, MA, USA). The ReverTra Ace qPCR RT Kit (FSQ-101) and SYBR RT-PCR kit (QPK-212) were purchased from Toyobo (Osaka, Japan). LPS was purchased from Sigma-Aldrich. Immunostimulatory DNA (ISD, TACAGATCTACTAGTGATCTATGACTGATCTGTACATGATCTACA) was purchased from Invivogen (San Diego, CA, USA).
+ Open protocol
+ Expand
3

In Vitro Chondrocyte Culture Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
Dulbecco's modified Eagle's medium/F12 culture medium, fetal bovine serum, penicillin-streptomycin, and 0.25% trypsin were purchased from Gibco (Thermo Fisher Scientific, Inc., Waltham, MA, USA). penicillin-streptomycin was purchased from CellGro (Corning Incorporated, Corning, NY, USA). Type II collagenase was purchased from Sigma-Aldirch (Merck KGaA, Darmstadt, Germany). Lipofectamine 2000 was purchased from Invitrogen (Thermo Fisher Scientific, Inc.). X-tremeGENE siRNA transfection reagent was purchased from Roche Diagnostics (Indianapolis, IN, USA). ReverTra Ace qPCR RT kit (FSQ-101) and SYBR dye were purchased from Toyobo Life Science (Osaka, Japan). micrON™ agomir-9, micrON™ agomir-control and miR-9 nucleotide fragment were designed and synthesized by Ribo Life Science Co., Ltd. (Soochow, China). Rabbit anti-MMP-13 antibody (sc-30073), mouse anti-collagen type II α1 chain (COL2A1) antibody (sc-52658) and rabbit anti-COL2A1 (sc-28887) were purchased from Santa Cruz Biotechnology, Inc. (Dallas, TX, USA). Horseradish peroxidase (HRP)-conjugated secondary antibody was purchased from Jackson ImmunoResearch Laboratories, Inc. (West Grove, PA, USA). The dual-luciferase reporter assay system and pGL3-promoter plasmids were purchased from Promega Corporation (Madison, WI, USA).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!