Pcag 1bpnls cas9 1bpnls 2agfp

CRISPR/Cas9-mediated gene editing (Suzuki et al., 2016 (link)) was performed as previously described (Wang et al., 2020 (link)) with a variety of modifications. In brief, SIRT7 gRNA (CAGCGTCTATCCCAGACTAC) targeting exon 4 of SIRT7 was cloned into gRNA-mCherry vector (SIRT7-gRNA-mCherry). The pCAG-1BPNLS-Cas9-1BPNLS-2AGFP plasmid was purchased from Addgene (#87109). After electroporation, cells were seeded on Matrigel-coated plates and treated with ROCK inhibitor (Tocris) in mTeSR. After 48 h of expansion, dual-positive cells were collected by FACS (BD FACS Aria II) and plated on MEF feeder cells in hESC medium. Emerging clones were manually picked into 24-well plates and then genomic DNAs of the clones were extracted for PCR and sequencing. The corrected hESC clones were homozygous for the addition of base A, resulting in TAA premature termination at both alleles and thus leading to complete knockout of SIRT7. hESC clones were then expanded on Matrigel-coated plates and gene knockout was confirmed by Western blot analysis. Primer sequences are shown in Table S1.

The gRNA cloning plasmid (gRNA_cloning vector), GFP-expression self-complementary AAV plasmid (pscAAV-CAG-GFP), GFP-containing plasmid (pCAG-1BPNLS-Cas9-1BPNLS-2AGFP), Cas9-expression AAV plasmid (pAAV-nEFCas9), and AAV donor backbone plasmid (pAAV-rMERTK-HITI) were obtained from Addgene (Addgene 41824, 83279, 87109, 87115, and 87119, respectively). To construct the myosin heavy chain 6 (Myh6) target gRNA-expression vector (mMyh6-gRNA), we designed the Myh6 target sequence (20 bp target and 3 bp PAM sequence (underlined)) as follows: GCAGCAGAAGATGCACGACGAGG. The Myh6 target was subcloned into the gRNA_cloning vector according to a previously reported protocol (https://media.addgene.org/data/93/40/adf4a4fe-5e77–11e2–9c30–003048dd6500.pdf (20 April 2020, date last accessed)) with the primers 5′- TGGCTTTATATATCTT
GTGGAAAGGACGAAACACCGCAGCAGAAGATGCACGACG-3′ and 5′- GCCTTATTTTAACTTGCTATTTCTAGCTCTAAAACCGTCGTGCATCTTCTGCTGC-3′. To construct a donor/gRNA AAV backbone plasmid (pAAV-Myh6GFP-HITI) for GFP knock-in at the Myh6 locus, U6-mMyh6gRNA and mMyh6GFP-HITI fragments were amplified from mMyh6-gRNA and pCAG-1BPNLS-Cas9-1BPNLS-2AGFP, respectively, using PrimeSTAR GXL DNA polymerase (Takara Bio, Inc., Shiga, Japan). These PCR fragments were subcloned into pAAV-rMERTK-HITI using an In-fusion HD Cloning Kit (Takara Bio, Inc.).

HIF-1α^−/− hESCs were generated by CRISPR/Cas9-mediated gene knockout as previously reported with some modifications (Hu et al., 2020 (link)). Briefly, guide RNA targeting exon 2 of HIF-1α was cloned into gRNA-mCherry vector (HIF-1α-gRNA-mCherry) and electroporated into wild-type hESCs with pCAG-1BPNLS-Cas9-1BPNLS-2AGFP (Addgene, #87109) by 4D-Nucleofector (Lonza). After electroporation, cells were seeded on Matrigel-coated plates and treated with ROCK inhibitor (Tocris) in mTeSR. After 48 h of expansion, dual-positive cells were collected by FACS (BD FACS Aria II) and plated on MEF feeder cells in hESC medium. Emerging clones were manually picked into 24-well plates and then genomic DNAs of the clones were extracted for PCR and sequencing. Guide RNA sequences for gene editing and primers for clone identification are listed in Table S3.