Taq polymerase

Manufactured by HiMedia

Sourced in India

Taq polymerase is a thermostable DNA polymerase enzyme isolated from the thermophilic bacterium Thermus aquaticus. It is a fundamental tool in molecular biology, used for DNA amplification and sequencing techniques such as Polymerase Chain Reaction (PCR).

Automatically generated - may contain errors

Lab products found in correlation

Spelling variants of this product

Taq DNA polymerase (4 citations)

7 protocols using taq polymerase

PCR Amplification of Viral Genomes

Check if the same lab product or an alternative is used in the 5 most similar protocols

The master mix for PCR amplification was prepared using synthesized cDNA (2 µL) as a template in a 20 µL reaction volume containing 1Xtaq buffer, 0.5 mM dNTPs, 1 U of Taq polymerase (HIMEDIA), 0.25 µM of each primer of APMV (F- 5′ATCCGAGTGAACAGTCTATCCCTC3′, R-5′GTAACTCACTCGTTATCACGTAC 3′) and ApNMV (F-5′ATGGTGTGCAATCGCTGTCAANMV3′, R- 5′CATCGACCATAAGGATATCA3′) and 1.5 mM MgCl₂ (magnesium chloride).The program was set up for 35 cycles with denaturation at 94 °C for 30 s, annealing at 46 °C (ApNMV) and 53 °C (ApMV) for 40 s, followed by extension at 72 °C for 30 s and a final elongation step at 72 °C for 10 min. Amplified products were visualized after electrophoresis in ethidium bromide (EtBr)-stained 1.2% agarose gel and the amplicon size was estimated using a 100 bp/1 kb DNA ladder (Invitrogen).

Nabi S.U., Mir J.I., Yasmin S., Din A., Raja W.H., Madhu G.S., Parveen S., Mansoor S., Chung Y.S., Sharma O.C., Sheikh M.A., Al-Misned F.A, & El-Serehy H.A. (2023). Tissue and Time Optimization for Real-Time Detection of Apple Mosaic Virus and Apple Necrotic Mosaic Virus Associated with Mosaic Disease of Apple (Malus domestica). Viruses, 15(3), 795.

+ Open protocol

+ Expand

Genomic DNA Extraction Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Xylene (Product No. 35415; Thermo Fisher Scientific, Waltham, MA, United States); Scalpel/razor blade; ethanol (Cat No. 58051; Jebsen & Jessen GmbH & Co., Hamburg, Germany); Tris HCl (Cat No. 34969; Sisco Research Laboratories Pvt. Ltd., New Delhi, India); EDTA dipotassium salt extrapure (Cat No. 62196; Sisco Research Laboratories Pvt. Ltd.); NaCl (Cat No. 15915; Qualigens Fine Chemicals, Mumbai, India); sodium lauryl sulphate (Cat No. 32096; Sisco Research Laboratories Pvt. Ltd.); proteinase K (Cat No. RM2957; HiMedia Laboratories, LLC, Mumbai, India); phenol molecular biology grade (Cat No. 17286; Sisco Research Laboratories Pvt. Ltd.); chloroform molecular biology grade (Cat No. 96764; Sisco Research Laboratories Pvt. Ltd.); isoamyl alcohol extrapure (Cat No. 69931; Sisco Research Laboratories Pvt. Ltd.); sodium acetate anhydrous extrapure (Cat No. 40104 K05; SDFCL, Bengaluru, India); nuclease-free water (Cat No. ML024; HiMedia Laboratories); mineral oil molecular biology grade (Cat No. MB161; HiMedia Laboratories); agarose low EEO (Cat No. MB002; HiMedia Laboratories); Taq polymerase (Cat No. MBT060A; HiMedia Laboratories); deoxynucleotriphosphates (Cat No. MBT078; HiMedia Laboratories); PCR tubes (Cat No. AB0620; Abgene, Portsmouth, NH, United States); microcentrifuge tubes (Cat No. 509-GRD-Q; QSP by Thermo Fisher Scientific).

Ramesh P.S., Madegowda V., Kumar S., Narasimha S., S R P., Manoli N.N, & Devegowda D. (2019). DNA extraction from archived hematoxylin and eosin-stained tissue slides for downstream molecular analysis. World Journal of Methodology, 9(3), 32-43.

+ Open protocol

+ Expand

Molecular Signaling Pathways in Cellular Processes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Acrylamide, N,N′-methylenebis-Acrylamide, and RETROscript (reverse transcriptase [RT]-PCR kit; Ambion; ThermoFisher Scientific) were procured from Invitrogen BioServices India Pvt. Ltd. Taq-polymerase was procured from HiMedia. Ethidium bromide (EtBr), agarose, sodium arsenite (NaAsO₂), diaminobenzidine (DAB), 2′,7′-dichlorofluorescin diacetate, and bovine serum albumin were obtained from Sigma-Aldrich. Goat Immunoglobulin G anti-rabbit and anti-mouse (alkaline phosphatase conjugated and horseradish peroxidase conjugated) were purchased from Genetex; 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium (BCIP-NBT) was bought from Santa Cruz Biotechnology; nitrocellulose membrane was purchased from GE HealthCare; Glycine, Tris and SDS were purchased from Amresco. Primary antibodies anti-TGF-β, anti-Smad2 (phospho [p]Ser467), anti-Smad3 (pSer423/425), anti-phosphatase and tensin homolog deleted on chromosome 10 (PTEN), anti-PI3Kp110α, anti-AKT (pSer473), anti-mTOR, anti-S6Kp70, anti-NF-κB/p65, anti-TAK1 (pThr184), anti-MAPKK3 (pSer189), anti-p38 MAPK, anti-MAPKK4 (pThr 261), anti-JNK, anti-E-cadherin, anti-desmoplakin, anti-vimentin, anti-N-cadherin, anti-Snail, anti-Slug, anti-Twist, anti-β-actin, and anti-Zeb1 were purchased from Genetex. Anti-Smad4 (pThr277) was purchased from ThermoFischer Scientific.

Ghosh A, & Roy M. (2023). Black Tea Extract, via Modulation of TGF-β Pathway, Prevents Inorganic Arsenic-induced Development of Squamous Cell Carcinoma of the Skin in Swiss Albino Mice. Journal of Cancer Prevention, 28(1), 12-23.

+ Open protocol

+ Expand

Apoptosis Pathway Protein Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Verso cDNA synthesis kit (AB1453A, Thermo Scientific), TRIzol Reagent (T9424, Sigma Aldrich), Taq Polymerase (MBT060A, Himedia), ready Mix dNTP (MBT078, Himedia), caspase-3 antibody (#9661, Cell signaling), BCL-2 antibody (SC-7382, Santa Cruz Technology), actin antibody (A02066, Sigma Aldrich), WesternSure-Premium Chemiluminescent substrate (WesternSure-Li-COR-Part No: 926-95000).

Chowdhury K., Sharma A., Kumar S., Gunjan G.K., Nag A, & Mandal C.C. (2017). Colocynth Extracts Prevent Epithelial to Mesenchymal Transition and Stemness of Breast Cancer Cells. Frontiers in Pharmacology, 8, 593.

+ Open protocol

+ Expand

PCR Confirmation of DGAT2 Transformation in Brassica napus

Check if the same lab product or an alternative is used in the 5 most similar protocols

Primary transformation events were confirmed by PCR using a specific primer pair based on BnDGAT2 DNA sequence of B. napus, F-DGAT2, GATTCTGCCTTCTTATCAGGTGACAC and R-DGAT2, CGAACCATCCATTTGTGAACAGG. The genomic DNA from transformed and untransformed cells was extracted by the DNeasy plant mini kit (Qiagen GmbH, Hilden, Germany). PCR reactions were performed in a 25-µL reaction volume containing five picomole each of both primers, 10 mm dNTP, 25 ng template DNA and 0.5 U Taq polymerase (Himedia Labs, Mumbai, India). The PCR amplification was carried out for 35 cycles (denaturation for 30 s at 95 °C, annealing for 30 s at 58 °C and extension for 1 min at 72 °C), including initial denaturation for 2 min at 95 °C and final extension for 10 min at 72 °C. The PCR product was electrophoresed on a 0.8% agarose gel.

Ahmad I., Sharma A.K., Daniell H, & Kumar S. (2014). Altered lipid composition and enhanced lipid production in green microalga by introduction of brassica diacylglycerol acyltransferase 2. Plant biotechnology journal, 13(4), 540-550.

+ Open protocol

+ Expand

PCR Genotyping Protocol for SSR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Polymerase chain reaction (PCR) was performed in 20 μl of the PCR reaction mixture containing 25 ng of template DNA, 200 μM of dNTPs, 1 × PCR buffer (10 mM Tris, pH 9.0, and 50 mM KCl), 1.5 mM MgCl₂, 2.5 U Taq polymerase (HiMedia Lab., Mumbai, India), and 10 pmol of both forward and reverse primers. The PCR programs were set at 94°C for 2 min (initial denaturation); followed by 35 cycles of 30 s at 94°C, 30 s at marker specific annealing temperature (Table 2), and 1 min at 72°C; with a final extension at 72°C for 7 min in a thermal cycler (Applied Biosystems Veriti™, CA, United States). The amplified products were resolved on 3% Super MT4 Agarose gel (Life Technologies, New Delhi, India) in 1× Tris-Borate-EDTA (TBE) buffer at 65–70 V for 2–3 h. DNA fragments were visualized under UV light and photographed using the gel documentation system (Bio-Rad Laboratories Inc., Hercules, CA, United States). The number of polymorphic alleles for each SSR locus was scored. The genotyping studies were repeated and confirmed before data analysis.

Prasad P., Thakur R.K., Savadi S., Bhardwaj S.C., Gangwar O.P., Lata C., Adhikari S, & Kumar S. (2022). Genetic Diversity and Population Structure Reveal Cryptic Genetic Variation and Long Distance Migration of Puccinia graminis f. sp. tritici in the Indian Subcontinent. Frontiers in Microbiology, 13, 842106.

+ Open protocol

+ Expand

Immobilization of DNA on Sepharose Beads

Check if the same lab product or an alternative is used in the 5 most similar protocols

(3-Aminopropyl)triethoxysilane (APTES), PCR buffer, MgCl₂, dNTP mix and Taq polymerase were purchased from Himedia Lab. Pvt. Ltd. 4B Sepharose beads, glutaraldehyde, aminoethanethiol HCl, 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC), and N-hydroxysuccinimide (NHS) were procured from Sigma-Aldrich, India. Acetone, isopropyl alcohol (IPA), and ethanol were obtained from Merck, India. ssDNA binding dye SYBR green II was obtained from Thermo Fischer Scientific. The glass substrates were obtained from University Wafer, USA. The AZ1512 HS photoresist was obtained from Microchemicals, USA. Lucentis and real samples (culture broth) were obtained from Bioseparations and Bioprocessing Laboratory, Department of Chemical Engineering, IIT Delhi, India.

Bhardwaj T., Rathore A.S, & Jha S.K. (2020). The selection of highly specific and selective aptamers using modified SELEX and their use in process analytical techniques for Lucentis bioproduction. RSC Advances, 10(48), 28906-28917.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!