The largest database of trusted experimental protocols

30 protocols using flag tag (flag)

1

Stimulation Assays of Immune Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Short-term stimulation assays were performed in 100 µl whole blood with 100 ng/ml CSF1 (Biolegend) and 100 ng/ml LPS Escherichia coli K12 (Invivogen). Longer stimulation assays (48 hours and 7 days) were performed on PBMCs in polypropylene plates in RPMI-1640 media supplemented with 10% FCS (Sigma). The 48 hours stimulation utilised the following immune stimuli: 100 ng/ml CSF1, 100 ng/ml IL-4, 100 ng/ml IFNγ (all Biolegend), 500 nM Dexamethasone (Sigma), 100 ng/ml LPS, 100 ng/ml PAM3CSK, 100 ng/ml FLAG, 100 ng/ml FSL1, and 108 Listeria cells (All Invitrogen). After stimulation, cells were harvested, and stained as above. The 7-day stimulation utilised the following LDCs: CSF1, IL-34, CSF2, CSF3, IL-3, IL-7, IL-15, and FLT3L (All 25 ng/ml, Biolegend). After stimulation, cells were harvested and stained as above.
+ Open protocol
+ Expand
2

Western Blot Antibody Immunodetection

Check if the same lab product or an alternative is used in the 5 most similar protocols
The following primary and secondary antibodies were used: Gαi1/2 (anti-sera) 58 (link), c-Myc (13–2500, Invitrogen), GFP (A11122, Invitrogen), HA (C29F4, Cell Signaling), FLAG (PA1–984B, Invitrogen). Streptavidin-IRDye800 was from LI-COR (925–32230). Primary antibodies were diluted in 3% bovine serum albumin (BSA) and 0.1% sodium azide and incubated with blots overnight at 4°C. Streptavidin-IRDye800 was incubated for 1 hour at room temperature. For secondary antibodies, goat anti-rabbit DyLight 800 (SA535571, Invitrogen) and goat anti-mouse IRDye 800CW (926–32210, LI-COR) were used at 1:10,000.
+ Open protocol
+ Expand
3

Quantitative Western Blotting Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
The following primary and secondary antibodies were used: Gαi1/2 (anti-sera) (56 (link)), c-Myc (13-2500, Invitrogen), GFP (A11122, Invitrogen), HA (C29F4, Cell Signaling Technology), FLAG (PA1-984B, Invitrogen). Streptavidin-IRDye800 was from LI-COR (925-32230). Primary antibodies were diluted in 3% bovine serum albumin and 0.1% sodium azide and incubated with blots overnight at 4 °C. Streptavidin-IRDye800 was incubated for 1 h at room temperature (RT). For secondary antibodies, goat anti-rabbit DyLight 800 (SA535571, Invitrogen) and goat anti-mouse IRDye 800CW (926-32210, LI-COR) were used at 1:10,000.
+ Open protocol
+ Expand
4

Expressing Ubiquitin and AR Variants

Check if the same lab product or an alternative is used in the 5 most similar protocols
For expression in cultured cells, EGFP tag-fused ubiquitin, FLAG-CNPY2, FLAG-MYLIP, MYLIP-His, FLAG-UBE2D1, UBE2D1-His and deletion mutants of FLAG-ARs (full length, 1-920 a.a.; AF-2, 555-920 a.a.; AF-1, 1-673 a.a.) were inserted into the pcDNA3 vector (Invitrogen, Carlsbad, CA, USA). To produce recombinant proteins in E.coli, CNPY2, UBE2D1 and the RING domain of MYLIP (344-445 a.a.) were inserted into pET29a (+) vector (Merck Millipore, DA, Germany) or the pGEX4T1 vector (GE Healthcare, Little Chalfont, England). siRNAs for CNPY2 (CNPY2HSS115810 and 115811) and MYLIP (MYLIPHSS120911 and 120912) were purchased from Invitrogen. Data in this report was shown as results using siCNPY2 (115810) and siMYLIP (120911), which had been more efficient at knockdown or cell growth than siCNPY2 (115811) in 22Rv1 cells. A nonspecific control siRNA pool (siControl) was purchased from Dharmacon (D-001206-13-20). The following antibodies were used: AR (N-20, C-19 or 441, Santa Cruz Biotechnology, Santa Cruz, CA, USA), CNPY2 (ab181215, Abcam, Cambridge, MA, USA), MYLIP (ab74562, Abcam), β-actin (A5441, Sigma, St. Louis, MO, USA), Ub (F-11, Santa Cruz Biotechnology), FLAG (F7425, Sigma), His (D291-3S, MBL, Nagoya, Japan), GST (B-14, Santa Cruz Biotechnology) and GFP (598, MBL).
+ Open protocol
+ Expand
5

Flag-tagged and Venus-tagged SCD5 Cloning

Check if the same lab product or an alternative is used in the 5 most similar protocols
PT2385 was obtained from Abcam, Cambridge, UK, and used at concentrations as indicated. SCD5 was subcloned by PCR from human cDNA (Agilent, Santa Clara, CA, USA), and fused by standard cloning techniques to a pcDNA6 vector encoding an N-terminal Flag-tag (Invitrogen, Carlsbad, CA, USA), and to a pLXSN vector with a Venus tag, a variant of the yellow fluorescent protein (YFP).
+ Open protocol
+ Expand
6

Western Blot Analysis of Protein Extracts

Check if the same lab product or an alternative is used in the 5 most similar protocols
Groups of proteins were extracted from transfected cells. After boiling for 5 min in 5% SDS-PAGE sample loading buffer, equal amounts of protein (50 μg) samples were separated by 12% SDS-PAGE and transferred to a nitrocellulose membrane. The membrane was blocked for 12 h at 4°C in PBS containing 10% skim milk. Specific antibodies against the FLAG tag (1:2,000, Invitrogen, USA), CacyBP/SIP (1:500, BOSTER, China), Caspase3 (1:300, Bioss, China), Bcl2 (1:500, BOSTER, China), Bax (1:500, BOSTER, China), and GAPDH (1:2,000, Sungene Biotech, China) were dissolved in PBS containing 1% skim milk, and then the membrane was treated with this solution. After incubation with the primary antibodies at 4°C for 12 h, the membrane was washed three times with PBST (PBS contain 0.5% Tween 20). Horseradis peroxidase-conjugated anti-rabbit/mouse IgG (1:3,000, Sungene Biotech, China) was then added. Detection was performed by incubating the membrane with Clarity Western ECL Substrate (Bio-Rad, California, USA), and then exposed the membrane in a dark room by using development and fixing baths. The film was developed artificially, and the results were analyzed using a Tanon-410 automatic gel imaging system.
+ Open protocol
+ Expand
7

SIRT6 Cloning and Mutagenesis Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
The following oligos (Genewiz) were used for RNA interference:
The following primers were used for ChIP qPCR:
The following gRNA sequences were used for CRISPR/Cas9 gene editing:
Human SIRT6 was cloned into pCDNA3.1 with a FLAG tag (Invitrogen, USA); a 3 × FLAG-SIRT1 and DR-GFP plasmids were obtained from Addgene. SIRT6ΔC and ΔN were amplified with specific primers and cloned into pKH3HA (Addgene) and pGex vectors (GE Healthcare Life Sciences). The SIRT6 KR, KQ and HY mutants were obtained by converting SIRT6 lysine 33 to arginine (KR), or to glutamine (KQ) and SIRT6 133 histidine to tyrosine (HY) via site-directed mutagenesis, as described below.
+ Open protocol
+ Expand
8

Amplification and Insertion of Truncated Glucocorticoid Receptor Variants

Check if the same lab product or an alternative is used in the 5 most similar protocols
GR coding sequences were obtained by the NCBI website (http://www.ncbi.nlm.nih.gov), and a series of truncated GR variants were amplified by PCR using the primers listed in Table 2, followed by insertion into the pcDNA3.1 vector with a Flag tag (Invitrogen).

The primers for constructs of GR truncates

GR (AA)Primer namePrimers’ sequences (5′−3′)
WTForwardCGGGATCCATGGACTCCAAAGAATCATTAACTC
ReverseCCGCTCGAGTCACTTTTGATGAAACAGAAGTT
402–777ForwardCGGGATCCATGGTAAGCTCTCCTCCATCCAG
ReverseCCGCTCGAGTCACTTTTGATGAAACAG
1–494ForwardCGGGATCCATGGACTCCAAAGAATC
ReverseCCGCTCGAGTCACTTTGTTTTTCGAGCTTC
1–530ForwardCGGGATCCATGGACTCCAAAGAATC
ReverseCCGCTCGAGTCAAGGGGTGAGTTGTGGTAA
531–777ForwardCGGGATCCATG ACCCTGGTGTCACTGTTG
ReverseCCGCTCGAGTCACTTTTGATGAAACAG
+ Open protocol
+ Expand
9

Immunofluorescent Labeling of S2 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Fixation and labeling of S2 cells were done as described previously (Wurm et al, 2010 ). In brief, cells were fixed using an 8% (wt/vol) formaldehyde solution, permeabilized by incubation with a 0.25% (vol/vol) Triton X-100 solution, and blocked with a 5% (wt/vol) BSA solution. Proteins of interest were labeled with antisera against the FLAG-tag (Thermo Fisher Scientific) and ATP5A (Abcam). Detection was achieved via secondary antibodies custom-labeled with Alexa Fluor 594 or STAR RED.
+ Open protocol
+ Expand
10

Western Blot Analysis of Tagged Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols
Strains were grown to an OD600 of 0.6 to 0.9, then 1 mM IPTG was added to induce protein production for 5 h. Cells were centrifuged (13,000 × g, 2 min) and sonicated, and the total proteins were resolved via 18% Tris-tricine-SDS gels. A Western blot was performed with primary antibodies raised against a His tag (Cell Signaling Technology, Danvers, MA) or a FLAG tag (Thermo Scientific, Waltham, MA), and horseradish peroxidase-conjugated goat anti-mouse secondary antibodies (Cell Signaling Technology). Blotted proteins were detected using the chemiluminescence reagents from the SuperSignal West-Pico Chemiluminescence kit (Thermo Scientific).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!