Gotaq green master mix 2x

Manufactured by Promega

Sourced in United States, Belgium

GoTaq® Green Master Mix 2X is a pre-formulated reaction mix containing GoTaq® DNA Polymerase, dNTPs, MgCl2, and reaction buffers. It is designed for routine PCR amplification and includes a green dye for visual tracking during gel electrophoresis.

Automatically generated - may contain errors

Lab products found in correlation

Spelling variants of this product

GoTaq Green Master Mix (1162 citations) GoTaq Master Mix (257 citations) GoTaq Green (69 citations) GoTaq Master mix (2X) (7 citations) GoTaq 2X (4 citations) GoTaq Hot Start Green Master Mix 2X (3 citations) GoTaq® G2 Green Master Mix 2X (3 citations) Green Master Mix 2X (2 citations)

42 protocols using gotaq green master mix 2x

Nested AS-PCR for Genetic Profiling

Check if the same lab product or an alternative is used in the 5 most similar protocols

There were two steps in the nested AS-PCR protocol. For the first PCR, each 20 µL of reaction mixture contained 40 ng of genomic DNA, 0.5 pM of each primer and 10 µL of GoTaq® Green Master Mix 2x (Promega Corporation, Madison, USA). The PCR conditions were 95°C for 3 minutes, followed by 26 cycles of 95°C for 30 seconds, and 63°C for 30 seconds, 72°C for 60 seconds; and finally 72°C for 7 minutes. 1 µL of the 100 fold-diluted PCR product was used as a template for the second step.
In the second step, three PCR reactions were performed in parallel in three separate tubes. Each 20 µL of the reaction mixture contained 1 µL of the diluted product of the first step, 0.5 pM of each primer and 10 µl of GoTaq® Green Master Mix 2x (Promega Corporation, Madison, USA).
For specificity enhancement, touchdown PCR cycles were used as follows: 95°C for 3 minutes; 5 cycles of 95°C for 30 seconds, 67°C for 30 seconds, 72°C for 30 seconds; 5 cycles of 95°C for 30 seconds, 65°C for 30 seconds, 72°C for 30 seconds; 10 cycles of 95°C for 30 seconds, 63°C for 30 seconds, 72°C for 30 seconds; 20 cycles of 95°C for 30 seconds, 58°C for 30 seconds, 72°C for 30 seconds; and finally 72°C for 7 minutes.

Pham T.T.H., Tran Q.B., Sukasem C., Nguyen V.D., Chu C.H., Do T.Q.N., Tran N.P.M., Nguyen H.H, & Phung T.H. (2021). A novel nested allele-specific PCR protocol for the detection of the HLA-A*33:03, a SCAR-associated allele, in Vietnamese people. Asian Pacific journal of allergy and immunology.

+ Open protocol

+ Expand

Genotyping Protocols for Mgrn1 and Parkin Mutant Mice

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Mgrn1^md-nc/md-nc (null) mutant mice (RRID:MGI:3704004) and co-isogenic controls have been described previously (He et al., 2003 (link); Silvius et al., 2013 (link)). Our in-house colony has been maintained by brother-sister inbreeding of Mgrn1^md-nc heterozygotes to homozygotes for over 60 generations. Animals were genotyped for the Mgrn1^md-nc mutation using allele-specific PCR as follows: wildtype primers: GCCTGCATGGATAGATGGAT and AGGAAGTTGCCCACAAGAACGCA; mutant primers: CAAGAACAACCAGGAGACTAAGGA and GCCCAAGTCCTAAACCTCT; amplification using Promega GoTaq green 2X master mix and 10 cycles with an annealing temperature of 60 C followed by 30 cycles with an annealing temperature of 57 C. Parkin (park2) null mutant mice (B6.129S4-Park2^tm1Shn/J, RRID:IMSR_JAX:006582) were obtained from the Jackson Laboratory and genotyped according to the standard PCR protocol (https://www.jax.org/strain/006582). All animal procedures adhered to the US National Research Council’s Guide for the Care and Use of Laboratory Animals, the US Public Health Service’s Policy on Humane Care and Use of Laboratory Animals, the Guide for the Care and Use of Laboratory Animals, and were approved by the McLaughlin Research Institute Institutional Animal Care and Use Committee (IACUC).

Gunn T.M., Silvius D., Lester A, & Gibbs B. (2019). Chronic and age-dependent effects of the spongiform neurodegeneration-associated MGRN1 E3 ubiquitin ligase on mitochondrial homeostasis. Mammalian genome : official journal of the International Mammalian Genome Society, 30(5-6), 151-165.

+ Open protocol

+ Expand

Conventional PCR Amplification of DNA

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Conventional PCR amplification was performed using 10 ng of extracted DNA with purity 1.7 to 2 in a total volume of 25 μL reaction volume using master mix (Go Taq green 2x master mix, Promega, USA) with primers (Bioneer, Korea) rPLU6 (5′-TTA AAA TTG TTG CAG TTA AAA CG 3′) and rPLU5 (5′-CCT GTT GTT GCC TTA AAC TTC-3); as described by Gal et al., 2001.24 (link) Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) with accession number NG 007073, GAPDH-F (5′-AGG TGG TCT CCT CTG ACT TCA AC-3′), GAPDH-R (5′-CGC CAG ACC CTG CAC TTT T-3′) was designed in this study with amplicon size 150 bp.
As the cycle conditions began with an initial denaturing period at 95°C for 5 min, followed by 35 cycles of 94°C for 30 s, 58°C for 1 min, and 72°C for 1 min, with a final extension for 5 min at 72°C.23 (link) PCR amplicon was separated on 1% agarose gel (Agarose, LE, Analytical Grade, Promega, USA). The presence of the 1200 amplicon was detected in the gel under UV light after its staining with Invitrogen ^TM SYBER ^TM Safe.

Bakr S., Edris S., Abdel Fattah N.S., Ibrahim N.M, & El-Khadragy M.F. (2017). Molecular Screening for Malaria among Blood Donors in a WHO Claimed Region of Egypt, Fayoum Governorate. Mediterranean Journal of Hematology and Infectious Diseases, 9(1), e2017065.

+ Open protocol

+ Expand

Genotyping Mice with Sox10LacZ Mutation

Check if the same lab product or an alternative is used in the 5 most similar protocols

Mice were maintained under standard conditions in a specific pathogen-free colony at the McLaughlin Research Institute. Before the gt mutation was identified, mice were genotyped by PCR using primers for the tightly linked microsatellite marker D15Mit71 (CCCAACTCATATGTATTATCCTGC and TAATGACAGTGCCAAATCTTGG). Once the mutation was identified, mice were genotyped by PCR using forward primer GGCCGAGGAACAAGACCTAT with allele-specific reverse primers CCTGGCTGACCGCCC (to detect the gt allele) or CCTGGCTGACCGCCT (to detect the wildtype allele). PCR was performed for 29–31 cycles using GoTaq Green 2X Master Mix (Promega) and an annealing temperature of 64 C. Sox10^LacZ mice were generated by the laboratory of Dr. Michael Wegner (Britsch et al. 2001 (link)). They were genotyped by PCR using forward primer CAGGTGGGCGTTGGGCTCTT with reverse primer CAGAGCTTGCCTAGTGTCTT (wildtype allele) or TAAAAATGCGCTCAGGTCAA (LacZ allele). All animal procedures adhered to Association for Assessment and Accreditation of Laboratory Animal Care guidelines and were approved by the Institutional Animal Care and Use Committee of the McLaughlin Research Institute.

Anderson S.R., Lee I., Ebeling C., Stephenson D.A., Schweitzer K.M., Baxter D., Moon T.M., LaPierre S., Jaques B., Silvius D., Wegner M., Hood L.E., Carlson G, & Gunn T.M. (2014). Disrupted SOX10 function causes spongiform neurodegeneration in gray tremor mice. Mammalian genome : official journal of the International Mammalian Genome Society, 26(0), 80-93.

+ Open protocol

+ Expand

Quantifying Mitochondrial Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA from breast tumors and normal breast tissues was reverse transcribed using Superscript III First Strand kit (Invitrogen, Carlsbad, CA). The RNA was isolated from cell lines by Trizol extraction method according to the manufacturer's protocol (Invitrogen) and reverse transcribed using the Superscript III First Strand kit (Invitrogen). RT PCR was performed to measure the expression levels of Polg1, ND2, ND4, ND5, Cyt b and COXI genes using GoTaq Green 2X Master Mix (Promega) and gene specific primers. β-actin was used as an internal control.

Singh B., Owens K.M., Bajpai P., Desouki M.M., Srinivasasainagendra V., Tiwari H.K, & Singh K.K. (2015). Mitochondrial DNA Polymerase POLG1 Disease Mutations and Germline Variants Promote Tumorigenic Properties. PLoS ONE, 10(10), e0139846.

+ Open protocol

+ Expand

Detecting kdr L1014F Mutation

Check if the same lab product or an alternative is used in the 5 most similar protocols

The protocol for kdr L1014F detection was adapted from a protocol described elsewhere (Martinez-Torres et al. 1999) . Briefly, two PCR reactions were run in parallel using 4 primers: Cgd1 (5′-GTGGAACTTCACCGACTTC-3′), Cgd2 (5′ GCAAGGCTAAGAAAAGGTTAAG-3′), Cgd3 (5′-CCACCGTAGTGATAGGAAATTTA-3′) and Cgd4 (5′-CCACCGTAGTGATAGGAAATTTT-3′). A 20 µl reaction volume was prepared for each reaction using the GoTaq® Green Master 2X Mix (M7122, Promega, Belgium) following the manufacturer's instructions.
The first reaction contained the primers Cgd1, Cgd2 and Cgd3 to identify the presence of the L1014 susceptible allele, and the second reaction consisted of Cgd1, Cgd2 and Cgd4 to identify the presence of the F1014 resistant allele. Taken together, the results of both reactions were used to determine the genotype for each individual as susceptible homozygote (L/L: SS), resistant heterozygote (L/F: RS), or resistant homozygote (F/F: RR). The cycle conditions were as follows: initial denaturation at 94°C for 2 min, 40 cycles of denaturation at 94°C for 30 sec, elongation at 48°C for 30 sec, extension at 72°C for 1 min, and a final hold stage at 72°C for 10 min. Amplicons were separated by electrophoresis on 1.5% agarose gel and were visualised by Midori green staining under UV light with FAS-V Imaging System.

Wang L., Soto A., Remue L., Rosales Rosas A.L., De Coninck L., Verwimp S., Bouckaert J., Vanwinkel M., Matthijnssens J, & Delang L. (2022). First Report of Mutations Associated With Pyrethroid (L1014F) and Organophosphate (G119S) Resistance in Belgian Culex (Diptera: Culicidae) Mosquitoes. Journal of medical entomology, 59(6).

+ Open protocol

+ Expand

Genotyping of Resistance Mutation

Check if the same lab product or an alternative is used in the 5 most similar protocols

This analysis was performed following a protocol described previously (Weill et al. 2004 ) with minor modifications. The DNA block was amplified using the primers CxEx3dir (5′-CGACTCGGACCCACTGGT-3′) and CxEx3rev (5′-GTTCTGATCAAACAGCCCCGC-3′) and a 20 µl reaction volume was prepared for each reaction using the GoTaq® Green Master 2X Mix (M7122, Promega, Belgium) following the manufacturer's instructions.
The cycle conditions were as follows: initial denaturation at 94°C for 2 min, 40 cycles of denaturation at 94°C for 30 sec, elongation at 54°C for 30 sec, extension at 72°C for 1 min, with a final hold stage at 72°C for 10 min. The amplicons were digested with AluI restriction enzyme (Jena Science, Sapphire, USA) following the manufacturer's instructions and separated on a 2% agarose gel. The products were visualised by Midori green staining under UV light with FAS-V Imaging System. The results were used to determine the genotype for each individual as susceptible homozygote (G/G: SS), resistant heterozygote (G/S: RS), or resistant homozygote (S/S: RR).

+ Open protocol

+ Expand

Nested PCR for ISMap02 genetic element

Check if the same lab product or an alternative is used in the 5 most similar protocols

Primers specific for the ISMap02 genetic element were selected for use in a nPCR format [19 (link)]. The primer sequences for the initial amplification were 5’-GCACGGTTTTTCGGATAACGAG-3’ (forward primer) and 5’-TCAACTGCGTCACGGTGTCCT G-3’ (reverse primer) and resulted in a 278-bp product. The primers nested within the first set, 5’-GGATAACGAGACCGTGGATGC-3’ (forward primer) and 5’ -AACCGACGCCGCCAATACG-3’ (reverse primer), were used for a second amplification reaction and yielded a 117-bp product. The reaction mixture consisted of ultrapure nuclease-free water, GoTaq^® 2X Green Master Mix (Promega), primers (forward and reverse). Controls consisted of reaction mixture alone (negative control) and a positive control containing 1 µL of genomic DNA from MAP.
The thermocycling protocol was as follows: 1 cycle at 94°C for 5 min and 30 cycles at 94°C for 45 s, 60°C for 1 min, and 72°C for 2 min followed by a final extension cycle at 72°C for 7 min. For the nPCR, the following protocol was used with 1 µL of the amplicon from the first PCR used as the template for the second amplification: 1 cycle at 94°C for 5 min and 30 cycles at 94°C for 45 s, 60°C for 1 min, and 72°C for 2 min, followed by a final extension cycle at 72°C for 7 min. PCR amplicons were then subjected to agarose gel electrophoresis in 1× TBE, and the gels were visualized under the gel documentation system.

Rani M., Narang D., Kumar D., Chandra M., Singh S.T, & Filia G. (2018). ISMap02 element targeted nested polymerase chain in the detection of Mycobacterium avium subsp. paratuberculosis in fecal samples of cattle and buffaloes. Veterinary World, 11(3), 397-401.

+ Open protocol

+ Expand

Genetic Profiling of BRAF, KRAS, HRAS, NRAS

Check if the same lab product or an alternative is used in the 5 most similar protocols

The primer sequences used to amplify exon 15 of BRAF; exon 1 and 2 of each KRAS, HRAS and NRAS gene along with their annealing temperatures and amplicon size are given in Table I. Each PCR reaction was executed in a final volume of 50 µl containing 2 each forward and reverse primers (20 pM/µl), 3 genomic DNA, 18 sterile water and 25 µl GoTaq 2X Green Master mix (Promega Corporation). PCR reaction was performed using the following thermocycling conditions: Initial denaturation for 5 min at 95˚C, followed by denaturation of template DNA for 35 sec at 94˚C, annealing for 35 sec and primer extension for 35 sec at 72˚C. Denaturation, annealing and primer extension steps were repeated for 35 cycles. Final extension was performed for 5 min at 72˚C as previously described (22 (link),25 (link)). The PCR product was run on 2% agarose gel and analysed using AlphaImager™ Gel Imaging System (ProteinSimple). Double distilled water (ddH₂O) was used as a negative control.

Rashid F.A., Bhat G.H., Khan M.S., Tabassum S, & Bhat M.H. (2021). Variations in MAP kinase gladiators and risk of differentiated thyroid carcinoma. Molecular and Clinical Oncology, 16(2), 45.

+ Open protocol

+ Expand

PCR-based Genotyping for dw3 Mutation

Check if the same lab product or an alternative is used in the 5 most similar protocols

Polymerase chain reaction (PCR)-based genotyping was performed to assay for presence or absence of dw3 mutation (tandem repeat of 882 bp on exon 5) with forward primer 5′-CGTCCTGCAGAAGATGTTCATGAAGG-3′ and reverse primer 5′-GTGCGCCACCACGATGGTGGTGC-3. The Promega GoTaq Green Master Mix, 2X, was used for a 25-μl total volume. The PCR assay was adapted from Farfan Barrero et al. (2012) . All the plants used in the msh1 memory line x Tx430 crosses were screened to confirm the absence of the DW3 allele that conditions a tall phenotype relative to Tx430. The F1 progeny was similarly screened.

Ketumile D., Yang X., Sanchez R., Kundariya H., Rajewski J., Dweikat I.M, & Mackenzie S.A. (2022). Implementation of Epigenetic Variation in Sorghum Selection and Implications for Crop Resilience Breeding. Frontiers in Plant Science, 12, 798243.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!