NPCs were transfected with biotin-labeled Bio-NC, Bio-miR-431-WT and Bio-miR-431-MUT RNA or Bio-NRF2-WT and Bio-NRF2-MUT RNA (50 nM) for 48 h. After washing with PBS, NPCs were incubated with lysis buffer containing protease inhibitor (Roche) and ribonuclease inhibitor (Fermentas, St. Leon-Rot, Germany) (20 mM Tris, pH 7.5, 200 mM NaCl, 2.5 mM MgCl2, 0.05% IGEPAL CA-630, and 1 mM dithiothreitol) on ice for 10 min. The lysate was cultured with magnetic beads coated by streptavidin (M-280, Invitrogen) at 4°C overnight. The RNase free BSA (Sigma-Aldrich) and yeast tRNA (Sigma-Aldrich) were used to precoat magnetic beads. Expression of circ_0072464 and miR-431 was detected by RT-qPCR.
Ribonuclease inhibitor
Manufactured by Thermo Fisher Scientific
Sourced in United States, Canada, Germany
The Ribonuclease inhibitor is a protein that binds and inhibits the activity of ribonucleases, enzymes that degrade ribonucleic acid (RNA). It is used to protect RNA samples from degradation during various molecular biology and biochemical applications.
Automatically generated - may contain errors
Lab products found in correlation
Dnase 1, by Thermo Fisher Scientific (11 mentions)
Trizol reagent, by Thermo Fisher Scientific (8 mentions)
Trizol, by Thermo Fisher Scientific (6 mentions)
Reverse transcriptase, by Thermo Fisher Scientific (5 mentions)
M mlv reverse transcriptase, by Thermo Fisher Scientific (5 mentions)
Evagreen, by Biotium (4 mentions)
Nanodrop 8000 spectrophotometer, by Thermo Fisher Scientific (4 mentions)
Cfx96 real time pcr detection system, by Bio-Rad (3 mentions)
Dithiothreitol (dtt), by Thermo Fisher Scientific (3 mentions)
Superscript 3 rt, by Thermo Fisher Scientific (3 mentions)
Nanodrop nd 1000 spectrophotometer, by Thermo Fisher Scientific (3 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (3 mentions)
Yeast trna, by Merck Group (2 mentions)
Rnase free bsa, by Merck Group (2 mentions)
Protease inhibitor, by Roche (2 mentions)
Cfx96 real time system c1000 thermal cycler, by Bio-Rad (2 mentions)
Taqman gene expression assay, by Thermo Fisher Scientific (2 mentions)
Iq supermix, by Bio-Rad (2 mentions)
Rneasy mini kit, by Qiagen (2 mentions)
Dntp mix, by Thermo Fisher Scientific (2 mentions)
45 protocols using ribonuclease inhibitor
1
Biotin-labeled RNA Immunoprecipitation
2
Quantitative Real-Time PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA was extracted from the cells using TRIzol reagent (Life Technologies), and cDNA synthesis was performed at 42°C for 1 h using 0.5 μg of the total RNA as a template, 0.4 μg of random hexamer primers and 200 U of reverse transcriptase (Fermentas) in the presence of 20 U of ribonuclease inhibitor (Fermentas). The obtained cDNAs were analyzed by quantitative polymerase chain reaction (PCR) using the CFX96 real-time PCR detection system (Bio-Rad Laboratories). Each reaction contained 50 mM Tris-HCl, pH 8.6, 50 mM KCl, 1.5 mM MgCl2, 0.1% Tween-20, 0.5 μM each primer, 0.2 mM dNTPs, 0.6 μM EvaGreen (Biotium), 0.75 U of Hot Start Taq Polymerase (Sibenzyme) and 50 ng of cDNAs. The PCR cycling conditions were as follows: initial denaturation for 5 min at 94°C, 40 cycles of 15 s at 94°C, 30 s at 65°C and 15 s at 72°C. The gene-specific primer pairs were: GAPDH - aaactgtggcgtgatggc and cagtggggacacggaagg; p16 – acaactgcccccgccacaac and acagtgaaaaggcagaagcggtg; p21 – aaggcagggggaaggtgggg and gggggagggacagcagcaga; H2B-tKR – cagccaccacacctacgag and tgaagccgatgaaggccag; H2B-miniSOG – gctttgtgattaccgatccgc and attttctgcacggtggcttg.
3
Quantitative PCR Analysis of RNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from cells using TRIzol reagent (Life Technologies). All of the RNA samples were further treated with DNase I (Fermentas) to remove the residual DNA. RNA (1 μg) was reverse transcribed in a total volume of 20 μl for 1 h at 42°C using 0.4 μg of random hexamer primers and 200 U of reverse transcriptase (Fermentas) in the presence of 20 U of ribonuclease inhibitor (Fermentas). The cDNA obtained was analysed by quantitative polymerase chain reaction (PCR) using the CFX96 real-time PCR detection system (Bio-Rad Laboratories). The PCRs were performed in 20 μl reaction volumes that included 50 mM Tris-HCl (pH 8.6), 50 mM KCl, 1.5 mM MgCl2, 0.1% Tween-20, 0.5 μM of each primer, 0.2 mM of each dNTP, 0.6 μM EvaGreen (Biotium), 0.75 U of Hot Start Taq Polymerase (Sibenzyme) and 50 ng of cDNA. The PCR reactions were performed as follows: initial denaturation for 5 min at 94°C; 50 cycles of 15 s at 94°C, 30 s at 65°C and 15 s at 72°C. The plate was then read. Each PCR was performed in quadruplicate, and the corresponding results were averaged. The primers used for qPCR analysis were as follows: GAPDH–aaactgtggcgtgatggc and cagtggggacacggaagg; p16–acaactgcccccgccacaac and acagtgaaaaggcagaagcggtg; p21–aaggcagggggaaggtgggg and gggggagggacagcagcaga.
4
Quantifying Angiogenesis Genes Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To determine the mRNA expression of the angiogenesis-modulating genes CD36, cyclooxygenase-2 (COX-2), interleukin-8 (IL-8), peroxisome proliferator-activated receptor γ and thrombospondin-1 (TSP-1) we performed real-time quantitative reverse transcriptase-PCR (qRT-PCR) on a CFX96 Real-Time System (C1000 Thermal Cycler; Bio-Rad Laboratories, Hercules, California, USA), with IQ Supermix (Bio-Rad Laboratories), using specific primers/probe sets (Hs00354519_m1, Hs01573471_m1, Hs00174103_m1, Hs01115513_m1 and Hs00170236_m1, respectively; TaqMan Gene Expression Assays; Applied Biosystems, Foster City, California, USA).
For cDNA synthesis, 9 μl of total RNA (1 μg RNA) was reverse transcribed in 20 μl of reaction mixture containing 10 mmol/l dNTPs, 5× reaction buffer, a random hexamer primer [pd(N)6], 40 U/μl ribonuclease inhibitor and 20 U/μl reverse transcriptase (Fermentas, Sunderland, UK). The reaction mixture was incubated at 70°C for 3 min, chilled on ice for 5 min, and incubated at 37°C for 1 h; the reaction stopped with incubation at 70°C for 10 min. qRT-PCR was performed with the following amplification settings: 50°C for 2 min and 95°C for 10 min for the AmpliTaq activation; thereafter, 40 cycles of 15 s denaturation at 95°C, 15 s annealing at 60°C, 1 min extension at 60°C and melting.
For cDNA synthesis, 9 μl of total RNA (1 μg RNA) was reverse transcribed in 20 μl of reaction mixture containing 10 mmol/l dNTPs, 5× reaction buffer, a random hexamer primer [pd(N)6], 40 U/μl ribonuclease inhibitor and 20 U/μl reverse transcriptase (Fermentas, Sunderland, UK). The reaction mixture was incubated at 70°C for 3 min, chilled on ice for 5 min, and incubated at 37°C for 1 h; the reaction stopped with incubation at 70°C for 10 min. qRT-PCR was performed with the following amplification settings: 50°C for 2 min and 95°C for 10 min for the AmpliTaq activation; thereafter, 40 cycles of 15 s denaturation at 95°C, 15 s annealing at 60°C, 1 min extension at 60°C and melting.
5
Quantitative Analysis of Angiogenesis Genes
6
Comprehensive Cell Culture Protocol for Diverse Applications
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Leibowitz L-15, α-MEM, streptomycin and penicillin, fetal bovine serum and trypsin were purchased from Life Technologies (Carlsbad, CA, USA). Bovine insulin, human transferrin, ascorbic acid, sodium selenite anhydrous, L-glutamine, sodium pyruvate, agarose (low gelling temperature), HEPES, equine chorionic gonadotropin (eCG) were purchased from Sigma (St Louis, MO, USA) and 5α-dihydrotestosterone (DHT) was purchased from Steraloids (Newport, RI, USA). Primary and secondary antibodies used in the present studies are shown in Supplementary Table 1 . Protein A/G PLUS-agarose (sc-2003) was purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Reagents for SDS-PAGE were supplied by Bio-Rad Laboratories (Mississauga, ON, Canada). RNeasy mini-kit and Quanti-Tect SYBR Green PCR kit were purchased from QIAGEN (Mississauga, ON, Canada). Primers used in the present studies are summarized in Supplementary Table 2 . Random decamer primers were purchased from Ambion (Austin, TX, USA). Ribonuclease inhibitor and deoxynucleotide triphosphate were purchased from Fermentas (Burlington, ON, Canada). Moloney murine leukemia virus reverse transcriptase was purchased from Promega (Madison, WI, USA). All set of PCR primers were purchased from Integrated DNA Technologies (Redwood, CA, USA).
7
Identifying ARRDC1-AS1 Binding to AGO2
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The binding of ARRDC1-AS1 to AGO2 protein was determined using RIP kit (17-701, Millipore, Billerica, MA) [31] (link). Cells were lysed in RIPA lysis buffer and centrifuged at 32876.4 g at 4 °C to harvest the supernatant. A part of the cell extract was taken out as Input, and the rest part was incubated for co-precipitation with the antibody rabbit anti-rat AGO2 (1: 100, ab32381, Abcam) or goat anti-rat IgG (1: 100, ab205719, Abcam). The magnetic bead-antibody complex was resuspended in 900 μL RIP Wash Buffer, and incubated with 100 μL cell extract overnight at 4 °C. The magnetic bead-protein complex was collected. The samples and Input were digested with proteinase K and RNA was extracted for subsequent PCR to determine the enrichment of ARRDC1-AS1.
BC cells were transduced with biotin-labeled Bio-NC, Bio-miR-4731-5p-WT and Bio-miR-4731-5p-Mut RNA (50 nM). After transduction for 48 h, the cells were washed with PBS, and incubated with in lysis buffer containing protease inhibitor (Roche) and ribonuclease inhibitor (Fermentas, St. Leon Rot, Germany) on ice for 10 min. The lysate was incubated with streptavidin-coated magnetic beads (M-280, Invitrogen) at 4 °C overnight. The magnetic beads were precoated with RNase free BSA (Sigma) and yeast tRNA (Sigma). The ARRDC1-AS1 enrichment was measured by RT-qPCR.
BC cells were transduced with biotin-labeled Bio-NC, Bio-miR-4731-5p-WT and Bio-miR-4731-5p-Mut RNA (50 nM). After transduction for 48 h, the cells were washed with PBS, and incubated with in lysis buffer containing protease inhibitor (Roche) and ribonuclease inhibitor (Fermentas, St. Leon Rot, Germany) on ice for 10 min. The lysate was incubated with streptavidin-coated magnetic beads (M-280, Invitrogen) at 4 °C overnight. The magnetic beads were precoated with RNase free BSA (Sigma) and yeast tRNA (Sigma). The ARRDC1-AS1 enrichment was measured by RT-qPCR.
8
RNA Purification and cDNA Synthesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Prior to reverse transcription, RNA samples were subjected to DNase treatment. It was carried at 37 °C for 30 min. in a 10 μl solution containing 1 μg of total cellular RNA, 1× reaction buffer (10 mM Tris–HCl pH 7.5, 2.5 mM MgCl2, 0,1 mM CaCl2), 10 U of ribonuclease inhibitor (MBI Fermentas) and 5 U of RNase-free DNase I (Boehringer Mannheim). To stop the reaction, the samples were supplemented with 1 μl of 25 mM EDTA and incubated in 65 °C for 10 min.
Resulting RNA preparation was directly used in reverse transcription set up with components and procedure of the First Strand cDNA Synthesis Kit (MBI Fermentas). This reaction was primed using either gene-specific oligo R (see below) or random hexamers from the kit. The former was used to produce cDNA for Pfu-driven amplification, the latter—to yield template for real-time PCR.
Resulting RNA preparation was directly used in reverse transcription set up with components and procedure of the First Strand cDNA Synthesis Kit (MBI Fermentas). This reaction was primed using either gene-specific oligo R (see below) or random hexamers from the kit. The former was used to produce cDNA for Pfu-driven amplification, the latter—to yield template for real-time PCR.
9
Total RNA Extraction and cDNA Synthesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from liver tissues (250 mg)
of each group using TRIZOL Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions. The isolated RNA was treated with DNase I (RNase-Free DNase, Fermentas Inc., Ontario, Canada) in the presence of ribonuclease inhibitor (Fermentas Inc., Ontario, Canada) . The treated RNA was extracted with phenol/ chloroform, precipitated with ethanol, and dissolved in RNase-free water. Reverse transcription was performed using M-MLV Reverse transcriptase (Fermentas Inc., Ontario, Canada) according to the manufacturer's instructions. In brief, 3 µg of total RNA from each sample was placed in a new tube and 1 µl of oligo(dT) 18 primers added followed by DEPC-treated water to 12 µl. The sample was gently mixed, spun down, and incubated at 70 o C for 5 minutes. On ice, the following were added: 5x reaction buffer 4 µl; ribonuclease inhibitor 1 µl, 10 mM dNTP mix 2 µl. Each tube was mixed gently and incubated at 37 o C for 5 minutes. After that, 1 µl of M-MLV Reverse transcriptase was added. The reaction was incubated at 42°C for 60 min and then inactivated by heating at 70°C for 10 min (Boonmars et al., 2011) .
of each group using TRIZOL Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions. The isolated RNA was treated with DNase I (RNase-Free DNase, Fermentas Inc., Ontario, Canada) in the presence of ribonuclease inhibitor (Fermentas Inc., Ontario, Canada) . The treated RNA was extracted with phenol/ chloroform, precipitated with ethanol, and dissolved in RNase-free water. Reverse transcription was performed using M-MLV Reverse transcriptase (Fermentas Inc., Ontario, Canada) according to the manufacturer's instructions. In brief, 3 µg of total RNA from each sample was placed in a new tube and 1 µl of oligo(dT) 18 primers added followed by DEPC-treated water to 12 µl. The sample was gently mixed, spun down, and incubated at 70 o C for 5 minutes. On ice, the following were added: 5x reaction buffer 4 µl; ribonuclease inhibitor 1 µl, 10 mM dNTP mix 2 µl. Each tube was mixed gently and incubated at 37 o C for 5 minutes. After that, 1 µl of M-MLV Reverse transcriptase was added. The reaction was incubated at 42°C for 60 min and then inactivated by heating at 70°C for 10 min (Boonmars et al., 2011) .
10
Honey Bee DNA and RNA Extraction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Four bees collected at each time point from each cage were used for individual DNA isolation, (N = 4 bees x 3 cages). DNAzol (Invitrogen, Carlsbad, CA) was used for DNA isolation from the collected honey bees according to the manufacturer's instructions. Four bees collected at each time point from each cage were used for individual RNA isolation (N = 4 bees X 3 cages). TRIzol (Invitrogen, Carlsbad, CA) was used for RNA extraction following the manufacturer's instructions. The resultant RNA pellets were resuspended in UltraPure DNase/RNase-Free water with the addition of Ribonuclease Inhibitor (Invitrogen, Carlsbad, CA). The quantity and purity of both DNA and RNA were measured using a NanoDrop 8000 Spectrophotometer (NanoDrop Technologies, Wilmington, DE). DNA samples were stored at -20°C and RNA samples were stored at -80°C until used.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!