Based on the biological functions of the DEGs and DEPs, 17 representative genes were selected to validate their expression level by qRT-PCR. The validation of genes was performed according to our previous protocol [21 (link)]. The cycle threshold (Ct) values and standard curves of the reference gene actin (ACT) at different concentrations (0.25, 0.5, 1.0, 1.5, 2.0, and 3.0 μL) were performed to correct expression level of selected genes (Figures S4 and S5 ). The primer sequence (Table S3 ) was designed using the primer-blast tool in NCBI and synthesized by Sangon Biotech (Shanghai, China). Total RNA samples at 2300 and 3300 m were extracted from the leaves using a Plant RNA Kit (R6827; Omega Bio-Tek, Norcross, GA, USA). cDNA was synthesized using a FastKing RT Kit (KR116; Tiangen, Beijing, China) with 42 °C for 15 min and 95 °C for 3 min for one cycle. The qRT-PCR was carried out using a SuperReal PreMix (FP205; Tiangen, Beijing, China) at 95 °C (15 min) for one cycle, followed by 95 °C (10 s), 60 °C (20 s), and 72 °C (30 s) for 40 cycles. The melting curve was analyzed at 72 °C for 34 s. TheREL was calculated using a 2−∆∆Ct method [72 (link)].
Superreal premix
Manufactured by Tiangen Biotech
Sourced in China, United States
SuperReal PreMix is a ready-to-use solution for real-time PCR (qPCR) reactions. It contains all the necessary components for the amplification and detection of target DNA sequences, including a DNA polymerase, dNTPs, and fluorescent probes.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (9 mentions)
Fastquant rt kit, by Tiangen Biotech (7 mentions)
Trizol reagent, by Tiangen Biotech (3 mentions)
M mlv reverse transcriptase, by Promega (2 mentions)
Fastking rt kit, by Tiangen Biotech (1 mentions)
Plant rna kit, by Omega Bio-Tek (1 mentions)
Nanodrop nd 1000, by Thermo Fisher Scientific (1 mentions)
Fastquant rt super mix, by Tiangen Biotech (1 mentions)
Dynamo cdna synthesis kit, by New England Biolabs (1 mentions)
Cfx96, by Bio-Rad (1 mentions)
Transzol, by Transgene (1 mentions)
High capacity cdna rt kit, by Thermo Fisher Scientific (1 mentions)
Mix x synthesis kit, by Takara Bio (1 mentions)
Tianamp genomic dna kit, by Tiangen Biotech (1 mentions)
Abi viia 7 real time pcr system, by Thermo Fisher Scientific (1 mentions)
First strand cdna synthesis kit, by Tiangen Biotech (1 mentions)
Kr116, by Tiangen Biotech (1 mentions)
Iq sybr green supermix, by Bio-Rad (1 mentions)
Cfx96 real time system, by Bio-Rad (1 mentions)
Abi stepone system, by Thermo Fisher Scientific (1 mentions)
35 protocols using superreal premix
1
Validating Differential Gene Expression
2
Quantifying Gene Expression in Cultured Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total ribonucleic acid (RNA) from cultured cells or tissues was extracted using Trizol reagent according to the manufacturer’s instructions. The total RNA was measured by a NanoDrop ND‐1000 spectrophotometer (Thermo Scientific, Waltham, MA, USA) and retrotranscribed immediately by the FastQuant RT Super Mix (KR108; TIANGEN Biotech, Beijing, China). Quantitative polymerase chain reaction (qPCR) was used with ABI PRISM 7500 fast real‐time PCR system (Applied Biosystems, Foster City, CA, USA) and the SuperReal PreMix (FP204; TIANGEN Biotech). GAPDH messenger RNA was considered the control. The primers for AMPK in quantitative real‐time PCR experiments were as follows: the forward primer F; 5′‐GGATCTTCTTCACGCCTCAG‐3′, and reverse primer R; 5′‐ TCCTCCCGAATCTCTTTG ATG‐3′. Primers for p53 were the forward primer F; 5′‐ATAAGAGTG GAGGGCAATCAGCGA‐3′, and reverse primer R; 5′‐AGTGATGATTGTGAGGATGGGCCT‐3′. Primers for Klf2 were the forward primer F; 5′‐CAGAATAACAGACGACGAAGA‐3′, and reverse primer R; 5′‐CGAGTCCGAGATTGTCAGA‐3′. Primers for GLUT12 were the forward primer F; 5′‐TACGGACGACGCTTACCAT‐3′, and reverse primer R; 5′‐GCCACTGACATCCCAACCA‐3′.
3
RNA Extraction and qRT-PCR Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted by the TRIzol reagent (Life Technologies) according to the manufacturer's instructions. Total RNA concentration was estimated by absorbance at 260 nm using an ultraviolet spectrophotometer, and its integrity was confirmed by denaturing agarose gel electrophoresis. The first-strand cDNA generation was performed with a DyNAmo cDNA Synthesis Kit (New England Biolabs). Quantitative real-time PCR (qRT-PCR) was carried out with SuperReal PreMix (Tiangen Biotech) in triplicate times. The relative expression level was normalized by internal reference β-actin through the 2-∆∆Ct method.
qRT-PCR primers for PTK7 are sense, 5′- catggtaccgttgtatgagca-3′, and antisense, 5′- ttgtctgtcacccactctgg-3′.
qRT-PCR primers for β-actin are sense, 5′ -tcccggcatgtgcaaggcc-3′, and antisense, 5′-catctcttgctcgaagtcca-3′.
qRT-PCR primers for PTK7 are sense, 5′- catggtaccgttgtatgagca-3′, and antisense, 5′- ttgtctgtcacccactctgg-3′.
qRT-PCR primers for β-actin are sense, 5′ -tcccggcatgtgcaaggcc-3′, and antisense, 5′-catctcttgctcgaagtcca-3′.
4
Quantitative Expression Analysis of CmHY5 Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TaqMan was used to detect the expression levels of CmHY5, CmoHY5-1, and CmoHY5-2 in various tissues. It was performed with a PCR machine (Bio-Rad, CFX96) using SuperReal fluorescence quantitative premix reagent (probe method) kit (TIANGEN) in a 20 μL reaction system (2× Super Real Premix (Probe) 10 μL, cDNA 2 μL, forward and reverse 0.6 μL each, primer 0.4 μL, ddH2O 6.4 μL)) for TaqMan analysis, with thermal cycling as follows: 95 °C for 15 min, 40 cycles for 3 s at 95 °C, and 25 s at 60 °C. The probe was modified by 5’-FAM. The Ct values obtained by the analysis were substituted into the standard curves of the three genes to calculate the absolute expression levels. The standard curves were made as follows: the mRNA sequences of CmHY5, CmoHY5-1, and CmoHY5-2 were connected to the TA cloning vector, and the recombinant plasmid was amplified by 10-fold gradient dilution. The diluted plasmid was used as a standard using the above system and method. TaqMan assay was performed, and a standard curve was drawn based on the natural logarithm of the Ct values and the plasmid concentrations. The standard curves of CmHY5, CmoHY5-1, and CmoHY5-2 were prepared, respectively.
5
Quantification of MEPE Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from the resected tissues, peripheral blood and cervical exfoliated cells using 1 ml TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) per 100 mg of tissue, according to the manufacturer's protocol. The phenol-chloroform method was used to extract the total RNA. Next, the RNA integrity was checked by 1% agarose gel electrophoresis, and the purity of RNA was determined by spectrophotometric detection of absorbance at 260/280 nm. Under the UV light, three bands of 28, 18, and 5 sec were observed, and the ratio of 28/18 sec was 2:1. cDNA was then synthesized from total RNA by the Reverse TIANScript II cDNA kit (cat. no. KR107; Tiangen Biotech Co., Ltd., Beijing, China) and stored in −20°C. The primers used in qPCR were as follows: MEPE forward, 5′-ATGCACACTCCCGACAGAGGA-3′ and reverse, 5′-CCTTGATGAGCATTTTGGCTGCT-3′; GAPDH forward, 5′-TGACCTTGCCCACAGCCTTG-3′, and reverse, 5′-CATCACCATCTTCCAGGAGCG-3′. The SYBR-Green qPCR analysis was performed using the SuperReal PreMix (Tiangen Biotech Co., Ltd.). The cycle conditions were the following: 95°C for 5 min, followed by 35 cycles at 95°C for 30 sec, 55°C for 30 sec and 72°C for 60 sec. The relative expression of MEPE was calculated using the 2−ΔΔCq method (18 (link)), compared with GAPDH as an internal control.
6
Ox-LDL-induced HBMEC Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Ox-LDL-induced HBMECs were collected and lysed using TransZol (TransGen, Beijing, China). RNA was reversely transcribed into cDNA with a High-Capacity cDNA RT Kit (Thermo Fisher) or MiX-x™ synthesis Kit (TaKaRa, Dalian, China). To determine the expression of circ_CHFR, checkpoint with forkhead and ring finger domains (CHFR), miR-15a-5p, and EGFR, SuperReal PreMix (Tiangen, Beijing, China) was employed. Data were analyzed with the 2−∆∆Ct method with U6 and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) as references. The sequences of forward and reverse primers were circ_CHFR 5′-CCCTCTGCAAGGAAGCCACG-3′ and 5′-TGCGCCGCCTGCCTTCTGTA-3′; CHFR 5′-CTCGTGTTGGGCTCGTGTC-3′ and 5′-GAGCAGGTTTCACAGGAGTCA-3′; miR-15a-5p 5′-CTCACGTAGCAGCACATAA-3′ and 5′-ACCTCAAGAACAGTATTTCCAGG-3′; EGFR 5′-GACGACAGGCCACCTCG-3′ and 5′-ATCGCTGCTCCCCGAAGA-3′; U6 5′-CTCGCTTCGGCAGCACATATACT-3′ and 5′-ACGCTTCACGAATTTGCGTGTC-3′; GAPDH 5′-AACGGATTTGGTCGTATTGGG-3′ and 5′-CGCTCCTGGAAGATGGTGAT-3′.
7
Relative mRNA Expression Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using TRIzol reagent (Thermo Fisher Scientific, Inc.) after different treatments in each group. A total of 1 μg extracted RNA was reverse-transcribed into cDNA using a FastQuant RT kit (Tiangen Biotech Co., Ltd.) at 42°C for 15 min and at 95°C for 3 min. SuperReal PreMix (Tiangen Biotech Co., Ltd.) was used for amplification of cDNA to the relative mRNA of genes in 10 μl of the final volume using a Real-Time PCR System (Biometra Biomedizinische Analytik GmbH). The thermocycling conditions were as follows: 95°C for 15 min, followed by 40 cycles at 95°C for 10 sec and at 60°C for 32 sec. The results were normalized against the housekeeping gene 18S. The forwards and reverse primers used are listed in Table II . The relative mRNA expression was calculated by using 2−ΔΔCq method (38 (link)).
8
RT-qPCR Assay for Sheep Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RT‒qPCR assays of the samples were performed using SuperReal PreMix (FP314) from Tiangen Biotechnology Co., Ltd. RT‒qPCR amplification was performed on all sampled parts of the sheep with positive PCR test results. The prepared plasmids with different concentration gradients can be amplified simultaneously. The amplification system included 6 μL ddH2O, 10 μL SYBR Green Master Mix, 1 μL B1-F, 1 μL B1-R, and 2 μL DNA. The amplification conditions were as follows: predenaturation at 95°C for 5 min followed by cycling and denaturation at 95°C for 10 s and annealing at 62°C for 30 s, for a total of 40 cycles.
9
Telomere Length Measurement Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TIANamp Genomic DNA kit (Tiangen, Beijing, China) was used to extract genomic DNA from gastrocnemius muscle. DNA concentration was measured using a microplate reader. Samples were quantified to a final concentration of 25 ng/1.5 µL to measure telomere length. qPCR was performed using SuperReal PreMix (SYBR Green, Tiangen, Beijing, China). Primers used were as follows: forward TEL 5′-GGT TTT TGA GGG TGA GGG TGA GGG TGA GGG TGA GGG t-3′, reverse TEL 50-TCC CGA CTA TCC CTA TCC CTA TCC CTA TCC CTA TCC CTA-30, forward AT1 5′-ACG TGT TCT CAG CAT CGA CCG CTA CC-3′, and reverse AT1 5′-AGA ATG ATA AGG AAA GGG AAC AAG AAG CCC-3′. The relative telomere length was measured by comparing the ratio of telomere repeat copy number (T as Tel1) and single-gene copy number (S as AT1), expressed as telomere length (T/S) ratio. Each value obtained by qPCR was processed through the formula T/S = 2−∆Ct, where ∆CT = CTtelomere − CTAT1. Each ratio was then compared with the ratio of the reference DNA. Each DNA sample collected was measured in duplicate.
10
qRT-PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The cDNA was reverse-transcribed using First Strand cDNA Synthesis Kit (Tiangen, Beijing, China) from 1 μg of total RNA. The SuperReal PreMix (SYBR Green) (Tiangen, Beijing, China) was used for the qRT-PCR analysis. And the qRT-PCR experiments were performed on the ABI ViiA 7 Real-Time PCR system (Applied Biosystems, Foster City, CA). The Table 1 displayed the specific primers for transcripts amplification. Each sample was tested in triplicate. Based on GAPDH as standardization, the relative expression levels of transcripts were calculated by 2-ΔΔCt means.
Primer sequence
| Primer | Forward (5′-3′) | Reverse (5′-3′) |
|---|---|---|
| GAPDH | TGCTGAGTATGTCGTGGAGTC | GGAGATGATGACCCTTTTGG |
| MMP19 | CTTCGAGTGGCAAAGGGCTA | GCACTAGGTCAAGTGCCCAT |
| COL12A1 | GACACCCCCTTCTGACAGTG | GAGGTCATGCAAGACTGCCT |
| CALCRL | GCGCATCCTATACGGTGTCA | AAGTGTTCAGTGGGGCAGTC |
| SCN5A | CTGACTATAGCCGCAGCGAA | AGCTTCCACACAGAGACACG |
| LRRC30 | CTATGTCCCGTGTGCCAAGT | TCCCCAAAACCCAAAGGGAC |
| NAV2 | CCGAAGGAGACCCACTGATG | GCTACTCTGCTCTGGCTTCAA |
| IGF1 | TTCACATCTCTTCTACCTG | TAGCCTGTGGGCTTGTTG |
| CTGF | GCGCCTGTTCTAAGACCTGT | GGCTTGGCAATTTTAGGCGT |
| AT1R | TGGCTGGCATTTTGTCTGG | CCTTGGGGCAGTCATCTTG |
| COL1A1 | GAAGTCATAGGAGTCGAGGGA | CATAGGACATCTGGGAAGCAA |
| COL3A1 | GGTTTCTTCTCACCCTGCTTC | ACAGAGGACAGATCCCGAGTC |
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!