The si-DNMT1 and si-DNMT3a and corresponding negative control were designed and synthesized by RiboBio (Guangzhou, China) and stored at −80 °C before use. Cells were transiently transfected with si-DNMT1 and si-DNMT3a and corresponding negative control using Lipofectamine 2000 reagent (Invitrogen) according to the manufacturer’s protocol.
Si dnmt1
Manufactured by RiboBio
Sourced in China
Si-DNMT1 is a laboratory equipment product designed for DNA methylation analysis. It functions as a DNA methyltransferase 1 (DNMT1) silencing reagent, enabling researchers to study the role of DNMT1 in various biological processes.
Automatically generated - may contain errors
Lab products found in correlation
3 protocols using si dnmt1
1
Silencing DNMT1 and DNMT3a
2
Regulation of Gene Expression via RNA Interference
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
miR‐1281 mimic, inhibitor, and their corresponding negative controls, small interfering (si)‐EGR1, si‐HDAC4, si‐DNMT1, and the negative control si‐negative control were chemically synthesized by Ribobio (China). The siRNA sense sequences designed were as follows: EGR1, 5′‐CCAACAGTGGCAACACTTT‐3′; si‐HDAC4, 5′‐GGATGAGCCCTACCTAGAT‐3′; and si‐DNMT1, 5′‐TATTGGTGCATACTCTGGGCT‐3′.
3
Lentiviral Transduction and miRNA Modulation in CD4+ T Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Lentiviral particles LV-sh-NC, LV-sh-LINC00240, OE-NC, OE-LINC00240 were cloned into the vectors and transfected into HEK293T cells using Lipofectamine 3000 (Invitrogen). CD4 + T cells were transduced with purified lentivirus as described [10] . si-NC, si-DNMT1, si-DNMT3a, si-DNMT3b, miRNA control (miR-NC), miR-155-5p mimics (miR-155-5p), miRNA inhibitor control (Anti-NC), miR-155-5p inhibitor (Anti-miR-155-5p) were obtained from RiboBio (Guangzhou, China). CD4 + T cells were transfected with siRNA or miRNA using Lipofectamine 3000 (Invitrogen). Cells were harvested for subsequent analysis at 48 h post-transfection.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!