Log In Sign up
The largest database of trusted experimental protocols

Environmental master mix

Manufactured by Thermo Fisher Scientific
Visit Supplier
Sourced in United States

The Environmental master mix is a pre-formulated reagent mixture designed for use in qPCR (quantitative Polymerase Chain Reaction) applications. It provides the necessary components, including buffers, enzymes, and fluorescent probes, to facilitate the amplification and detection of target DNA sequences from environmental samples.

Automatically generated - may contain errors

Lab products found in correlation

Quantstudio 3, by Thermo Fisher Scientific (2 mentions) Universal master mix, by Thermo Fisher Scientific (1 mentions) Mx3005p, by Agilent Technologies (1 mentions)

Spelling variants of this product

TaqMan Environmental Master Mix 2.0 (39 citations) TaqMan Environmental Master Mix (3 citations) TaqMan environmental master mix (version 2.0) PCR buffer (3 citations) Environmental Master Mix (version 2.0) PCR buffer (3 citations) TaqMan Environmental PCR master mix (2 citations) ABI TaqMan Environmental Master Mix 2.0 (2 citations)

4 protocols using environmental master mix

1

Improved TaqMan qPCR assay for Alexandrium detection

Check if the same lab product or an alternative is used in the 5 most similar protocols
After identifying a suitable multi-target assay (Catherine et al., 2009 ), which amplifies the 18S rDNA sequence of Alexandrium spp. It was decided that a redesign of the PCR assay was required. The new TaqMan qPCR assay includes degeneracies to help improve coverage of target species more recently included in public databases. The assay targets a 125bp region of the 18S rDNA gene and was developed by de novo alignment of 25 Alexandrium species. The primers and MGB (minor groove binding) probe for the assay are shown in Table 1. Primers and probes were synthesized by Sigma life sciences (Sigma-Aldrich St Louis, Mi, USA) and prepared in TE buffer. All qPCR analyses were performed on an MX3005P instrument (Agilent Technologies, Santa Clara, Ca, USA), with the following process: 37 °C for 10 min, 95 °C for 10 min and 50 repeat cycles of 95 °C for 15 s and 63 °C for 1 min with fluorescence measured during each 63 °C step. PCR reactions used either universal master mix or environmental master mix as specified in the results section below (Thermo Fisher, Waltham Ma, USA) with Rox as a passive reference dye.

TaqMan primer & probe sequences.

Table 1
NameSequence (5′-3′)
Alex-FWDTGTTGCGGTTAAAAAGCTCGTAG
Alex-REVTGCACTTGACTGTGTGGTGTM
Alex MGB Probe (FAM)TGAGTATYTGGCACAGCC
Hatfield R.G., Bean T., Turner A.D., Lees D.N., Lowther J., Lewis A, & Baker-Austin C. (2019). Development of a TaqMan qPCR assay for detection of Alexandrium spp and application to harmful algal bloom monitoring. Toxicon: X, 2, 100011.
+ Open protocol
+ Expand
2

Quantifying Rhodococcus and Arthrobacter in Samples

Check if the same lab product or an alternative is used in the 5 most similar protocols
Primers were designed for targeting the respective 16s regions of R. rhodochrous and Arthrobacter AK-19. Primers and Taqman probe targeting R. rhodochrous 21198 16s included forward primer: 5′ACGACGTCAAGTCATCATGC; reverse primer: 5′ GTATCGCAGCCCTCTGTACC; probe (VIC fluorophore): VICTATGTCCAGGGCTTCACACAMGBNFQ. Primers and Taqman probe targeting Arthrobacter AK-19 16s included forward primer: 5′ GTGGGTACGGGCAGACAGA; reverse primer: 5′ CTACGCATTTCACCGCTACA; probe (FAM fluorophore): 6FAMGTGCAGTAGGGGAGACTGGAMGBNFQ. Ten-fold dilutions were created for standards using known concentrations of R. rhodochrous 21198 and Arthrobacter AK-19. Standards were analyzed in triplicate, samples were analyzed in duplicate, and qPCR reactions were multiplexed. Conditions for qPCR included 3 μL of template, 1 μL each of forward and reverse primers (2.5 μM), 2.5 μL each of probe (0.125 nM), and 12.5 μL Environmental MasterMix (ThermoFisher). Cycling conditions included an initial melting temperature of 95°C for 3 min, following by 40 cycles of 95°C for 1 min, 55°C for 30 s, and 72°C for 45 s.
Kooienga E.M., Baugher C., Currin M., Tomberlin J.K, & Jordan H.R. (2020). Effects of Bacterial Supplementation on Black Soldier Fly Growth and Development at Benchtop and Industrial Scale. Frontiers in Microbiology, 11, 587979.
+ Open protocol
+ Expand
3

Microbial Source Tracking in Water

Check if the same lab product or an alternative is used in the 5 most similar protocols
Previously validated probe-based MST methods (Table 1) were used to determine the major sources of fecal contamination in each water sample. In addition to MST markers, enterococci markers were also enumerated to provide an additional measure of overall fecal contamination in each sample. Briefly, 25 μL qPCR reactions consisted of 1X Environmental Master Mix (Life Technologies, Carlsbad, CA, USA), assay-specific oligonucleotide concentrations (Table 1), and two microliters DNA extract. Triplicate reactions for each sample were run on a QuantStudio 3 (Life Technologies) using default cycling conditions as follows: 50 °C for 2 min, 95 °C for 10 min, and 40 cycles of 95 °C for 15 s and 60 °C for 1 min. Before data export, the baseline was set to ‘automatic’ and the fluorescence threshold to 0.03.
Green H., Weller D., Johnson S, & Michalenko E. (2019). Microbial Source-Tracking Reveals Origins of Fecal Contamination in a Recovering Watershed. Water, 11(10), 2162.
+ Open protocol
+ Expand
4

Microbial Source Tracking in Water

Check if the same lab product or an alternative is used in the 5 most similar protocols
Previously validated probe-based MST methods (Table 1) were used to determine the major sources of fecal contamination in each water sample. In addition to MST markers, enterococci markers were also enumerated to provide an additional measure of overall fecal contamination in each sample. Briefly, 25 μL qPCR reactions consisted of 1X Environmental Master Mix (Life Technologies, Carlsbad, CA, USA), assay-specific oligonucleotide concentrations (Table 1), and two microliters DNA extract. Triplicate reactions for each sample were run on a QuantStudio 3 (Life Technologies) using default cycling conditions as follows: 50 °C for 2 min, 95 °C for 10 min, and 40 cycles of 95 °C for 15 s and 60 °C for 1 min. Before data export, the baseline was set to ‘automatic’ and the fluorescence threshold to 0.03.
Green H., Weller D., Johnson S, & Michalenko E. (2019). Microbial Source-Tracking Reveals Origins of Fecal Contamination in a Recovering Watershed. Water, 11(10), 2162.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!