The largest database of trusted experimental protocols

3 protocols using tbx21

1

Transcription Factor Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells were lysed in RLT buffer (Qiagen) containing 1% 2-mercaptoethanol and subsequently homogenized using the QIAshredder (Qiagen). The total RNA was obtained with the RNeasy® mini/micro kit (Qiagen), whereas the complementary DNA was generated using a SuperScript™ VILO cDNA Synthesis Kit (Invitrogen) and used as a template for quantitative RT-PCR performed with the Fast Start Essential DNA Green Master kit (Roche). Primers for TBX21, GATA3, RORC, FOXP3, MAF, and AHR were purchased from Qiagen. A primer for ACTB was designed as follows: forward 5′-CACTCTTCCAGCCTTCCTTCC-3′, reverse 5′-GCATACAGGTCTTTGCGGATG-3′.
+ Open protocol
+ Expand
2

Transcriptional Profiling of T Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated from T cells using TRIzol (Life Technologies). Reverse transcription was performed using the Verso cDNA Synthesis Kit (Thermo Scientific). Quantitative PCR reactions were prepared by using Bio-Rad SYBR green master mix and performed on an Applied Biosystems thermocycler (7900 HT). Primers against murine Ddit3 forward (GGAGCTGGAAGCCTGGTATG) reverse (GGATGTGCGTGTGACCTCTG), Atf4 forward (GCCTGACTCTGCTGCTTA) reverse (GCCTTACGGACCTCTTC), Eif2ak3 forward (ATCGCAGAGGCAGTGGAGTT) reverse (AGGCTGGCATTGGAGTCAGT), and Actb forward (TGTGATGGTGGGAATGGGTCAGAA) reverse (TGTGGTGCCAGATCTTCTCCATGT) were from IDT. Primers for murine Il12b2, Cxcr3, Ifng, Gzmb, Tbx21, Cbfa3, Eif2ak1, Eif2ak2, and Eif2ak4 and human DDIT3 were purchased from QIAGEN. Relative expression was calculated using the ΔΔCt method and normalized to actb levels.
+ Open protocol
+ Expand
3

Quantitative Real-Time PCR Analysis of Immune Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was converted to cDNA using the RT2 first strand kit (QIAGEN) as per the manufacturer's instructions. Quantitative real‐time PCR reactions were carried out on a Rotor‐Gene Q (QIAGEN) using cDNA from the above reaction, RT2 SYBR Green qPCR Mastermix (QIAGEN) and primers RPLP0 (housekeeping gene, Cat PPH21138F) IL‐4 (CAT PPH00565B), IL‐13 (CAT PPH00688F), TNF (CAT PPH00341F), IFNγ (CAT PPH00380C), RORC (CAT PPH05877A), TBX21 (Cat PPH00396A) and GATA3 (CAT PPH02143A, all purchased as commercial primers (QIAGEN). Reaction wells each contained 20 μL of reaction mix with cycling conditions as per the manufacturer's instructions. Each qPCR reaction was tested in triplicated for each gene. Fold change was expressed relative to the housekeeper gene (which was reliably detected in each experiment) and determined by the calculation 2−ΔCT.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!