Sigenome non targeting control sirna pool 2

Manufactured by Horizon Discovery

Sourced in United States

The SiGENOME Non-Targeting Control siRNA Pool #2 is a collection of four individual synthetic small interfering RNA (siRNA) molecules that do not target any known gene in the human, mouse, or rat genome. This pool is designed to serve as a control in RNA interference (RNAi) experiments, helping to distinguish specific gene silencing effects from non-specific cellular responses triggered by the introduction of siRNA.

Automatically generated - may contain errors

Lab products found in correlation

Lipofectamine rnaimax transfection reagent, by Thermo Fisher Scientific (2 mentions) Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions) Interferin, by Polyplus Transfection (1 mentions) Jetprime reagent, by Polyplus Transfection (1 mentions) Smartpool sirna, by Horizon Discovery (1 mentions) Lipofectamine rnaimax reagent, by Thermo Fisher Scientific (1 mentions) Sigenome smartpool, by Horizon Discovery (1 mentions)

Close spelling variants of this product

SiGENOME Non-Targeting siRNA Control Pool SiGENOME Control pool non-targeting #2 SiGENOME Non-Targeting siRNA Pool #2 SiGENOME Control Pool Non‐Targeting SiGENOME Non-Targeting siRNA pool SiGENOME Non-Targeting Pool #2 SiGENOME Non-Targeting Control siRNA Non-targeting control siRNA pool SiGENOME Non-Targeting siRNA #2 Non-Targeting siRNA Pool #2

3 protocols using sigenome non targeting control sirna pool 2

Detailed Protocol for siRNA and shRNA Targeting

Check if the same lab product or an alternative is used in the 5 most similar protocols

ON-TARGET plus siRNA Human DPYS siRNA SMARTpool (siDHP-SP) (L-008455-00), ON-TARGET plus siRNA Human DPYS (siDHP-1) (J-008455-07) (GCACAGAUGGCACUCACUA), siGENOME SMARTpool Human DPYD (M-008376-02), ON-TARGETplus FANCM siRNA (L-021955-00), siGENOME SMARTpool Human FANCD2 (M-016376-02), siGENOME SMARTpool Human FANCA (M-019283-02), siGENOME SMARTpool Human SPRTN (M-015442-02), siGENOME SMARTpool Human XPA (M-005067-01), siGENOME SMARTpool Human ERCC5 (M-006626-01), siGENOME SMARTpool Human UPP1 (M-006647-01), siGENOME Non-targeting Control siRNA pool 2 (D-001206-14) and ON-TARGET plus Non-Targeting Pool (D-001810-10), were purchased from Dharmacon. siDHP-2 (GAAUAGCUGUAGGAUCAGATT) was purchased from Eurofins MWG. shDHP-3: DPYS MISSION plasmid (Sigma Aldrich, TRC0000046747), target sequence (TGTGGCAGTTACCAGCACAAA) and shDHP-4: DPYS MISSION plasmid (Sigma-Aldrich, TRC0000046744), target sequence (CTAATGATGATCTAACCACAA). Puro-shRNA FANCM used was described in (34 (link)). SiRNAs were transfected with INTERFERin (Polyplus), shRNA with Lipofectamine 2000 (Invitrogen). Plasmids encoding cDNAs were transfected using jetPEI or jetPRIME reagent (Polyplus).

Basbous J., Aze A., Chaloin L., Lebdy R., Hodroj D., Ribeyre C., Larroque M., Shepard C., Kim B., Pruvost A., Moreaux J., Maiorano D., Mechali M, & Constantinou A. (2019). Dihydropyrimidinase protects from DNA replication stress caused by cytotoxic metabolites. Nucleic Acids Research, 48(4), 1886-1904.

+ Open protocol

+ Expand

siRNA-mediated Knockdown of mOct4pg9 in Neural Stem Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

100 nM of Smart pool siRNA targeted against mOct4pg9 or siGENOME Non-Targeting Control siRNA Pool #2 (Dharmacon, Lafayette, CO) (Sequences in Supplementary File 1b) was transfected into the neural stem cells using lipofectamine RNAiMAX Transfection reagent (Thermo Fisher Scientific), after 48 hours the cells were harvested, and RNA or protein were isolated (see below). On average, siRNA-mediated knockdown resulted in a 31.67±8.79% decrease in mOct4pg9 RNA expression (t₍₅₎=3.599, p=0.016) relative to control.

Salem N.A., Mahnke A.H., Tseng A.M., Garcia C.R., Jahromi H.K., Geoffroy C.G, & Miranda R.C. (2020). A novel Oct4/Pou5f1-like non-coding RNA controls neural maturation and mediates developmental effects of ethanol.. Neurotoxicology and teratology, 83, 106943.

+ Open protocol

+ Expand

Knockdown of ACTN1 and ACTN4 in DLD-1 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Small interfering RNAs (siRNAs) targeting human ACTN1 and ACTN4 (siGENOME SMARTpool) and siGENOME Non-Targeting Control siRNA Pool #2 were purchased from GE Dharmacon (Lafayette, CO, USA). siRNAs were transfected into DLD-1 cells with Lipofectamine RNAiMAX reagent (Life Technologies) at a final concentration of 10 nM. The transfected cells were cultured in a growth medium for 48–72 h before being subjected to western blotting or immunofluorescence staining.

Fukumoto M., Kurisu S., Yamada T, & Takenawa T. (2015). α-Actinin-4 Enhances Colorectal Cancer Cell Invasion by Suppressing Focal Adhesion Maturation. PLoS ONE, 10(4), e0120616.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!