The largest database of trusted experimental protocols

17 protocols using primer premier 5

1

Constructing Fluorescent Protein-Tagged Plasmids

Check if the same lab product or an alternative is used in the 5 most similar protocols
A pair of primers was designed by Primer premier 5.0 and synthesized by Invitrogen (USA). To facilitate cloning, HindIII or BamHI restriction sites (underlined) were incorporated into the forward primer (5'-CCAAGCTTCGATGGCTTCTATGGAGACAGC-3') and reverse primer (5'-CGGGATCCTTACCAATCTACCCTAAACATG-3'), respectively. Primers for amplifying DEV gM (forward: 5'-CTCGAGATGGGATCCATGAATGGGC-3' and reverse: (5'-CCGCGGTTCACTATCCGACGAGAAATGAGT-3') containing XhoI or SacII restriction sites (underlined), respectively, were also designed by Primer premier 5.0 and synthesized by Invitrogen (USA). Using DEV CHv DNA as the template, the PCR was performed with reactions (20 µL/tube) containing 10 µL PrimeSTAR (premix) DNA polymerase, 0.4 µL of each primer (10 pmol each), 0.3 µL DNA template, and 8.9 µL ultrapure water.
DEV UL49.5 PCR products and pEGFP-C1 were digested by HindIII or BamHI, respectively, and then ligated with T4 ligase to produce the pEGFP-C1/pUL49.5 plasmid (Fig. 1A). The pDsRed1-N1/gM plasmid was constructed in the same way following digestion by XhoI and SacII (Fig. 1B). Successful production of the pEGFP-C1/pUL49.5 and pDsRed1-N1/gM plasmids was subsequently confirmed by PCR, restriction enzyme digestion, and sequencing as previously described [6 (link)].
+ Open protocol
+ Expand
2

Transcriptional Regulation in B. amyloliquefaciens

Check if the same lab product or an alternative is used in the 5 most similar protocols
The total RNA were isolated from B. amyloliquefaciens cultures using TRIzol Reagent (Invitrogen, Carlsbad, CA, USA) and then treated with RNase-free DNase. First-strand cDNA was conversed from total RNA using an RT-PCR kit (Fermentas, Vilnius, Lithuania15 (link)). Real-time PCR was performed as described in the paper.16 (link) Band intensities were normalized to the 16S rDNA transcript band for 2−ΔΔCT relative quantification. The B. amyloliquefaciens nucleotide sequences for these genes were obtained from the NCBI GenBank database. Primer pairs were designed from these sequences with Primer Premier 5.0 software (Applied Biosystems), the 16S rDNA primers used were F(5-CCTACGGGAGGCAGCAG-3) and R (5-ATTACCGCGGCT GCTGG-3), the comA primers were F (5-TCAAAGTGAGCAGGATCGGTTAA-3) and R (5-CTTCTGTACGGGAGCCGACAT-3) and spo0A primers were F (5-TTGCGGCG ATGAAGTGAATG-3) and R (5-CGATGGAAAGCTGCGGTGTA-3).
+ Open protocol
+ Expand
3

Comprehensive Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from frozen colon and ileum mucosal tissues (n = 3) using TranzolUp reagent (TransGen Biotech, China) according to the manufacturer's instructions. The concentration and quality of extracted total RNA were determined by a NanoDrop-ND2000 spectrophotometer (Thermo Fisher Scientific Inc., Germany). The integrity of total RNA was further checked by gel electrophoresis on a 1% agarose gel for visualization of complete 28 and 18S bands. Genomic DNA was eliminated by treatment with DNase I (TransGen Biotech, China). Complementary DNA (cDNA) was then synthesized from 1 μg of total RNA using an M-MLV First Strand Kit (Invitrogen, USA) following the instructions of the manufacturer. The qRT-PCR for gene expression was performed in duplicate using a ChamQTMSYBR®qPCR Master Mix (Vazyme Biotech Co., China) on a CFX connect system (Bio-Rad, USA). Specificity of the amplification was confirmed by the melting curve. Primers were designed using Primer Premier 5.0 software (Applied Biosystems, USA) and were synthesized by Generay Biotech Co. (Shanghai, China). Primer sequences, annealing temperatures (Tm), and product lengths of target genes are listed in Table S2. The fold change of the target genes was normalized to housekeeping gene (β-actin) and was calculated using the 2−ΔΔCT method.
+ Open protocol
+ Expand
4

Validating RNA-Seq Data with qRT-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols
To validate the RNA-Seq data, qRT-PCR was performed on 19 randomly selected DEGs. Total RNA was reverse-transcribed into cDNA using the PrimeScript RT reagent kit with gDNA Eraser (TaKaRa), according to the manufacturer’s instructions. Primers were designed according to sequence information from the NCBI database using Primer Premier 5.0 software (Applied Biosystems) (Supplementary Table S7). qRT-PCR was performed in a final reaction volume of 15 µL with the SYBR® Green PCR Master Mix Kit (TaKaRa, Osaka, Japan) in the CFX96 Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA), using the following protocol: 95 °C for 10 min; 40 cycles of 95 °C for 15 s and 60 °C for 1 min. All reactions were performed in triplicate for each sample, and GAPDH was employed as a reference gene for the normalisation of gene expression levels. The relative gene expression values were calculated using the 2−ΔΔCt method59 (link). Comparisons of gene expression levels based on prolificacy levels were performed using the t-test, and the correlations between the qRT-PCR and RNA-Seq measurements were calculated.
+ Open protocol
+ Expand
5

Quantification of Human RIG-G Gene

Check if the same lab product or an alternative is used in the 5 most similar protocols
The complete nucleotide sequences of human RIG-G gene and human GAPDH were retrieved from the GenBank (https://www.ncbi.nlm.nih.gov/genbank/, accessed on 28 June 2021) database, and compared with DNASTAR software (DNASTAR, Madison, WI, USA). The primers and TaqMan probe were selected to locate in the highly conserved site of the non-coding region of human RIG-G gene. All primers used in the amplification are designed by Primer Premier 5.0 software (Applied Biosystems, San Francisco, CA, USA). The primers and TaqMan probe were synthesized and purified by Novo Biotechnology Co., Ltd (Shanghai, China). The 5′end of the probe is labeled with a reporter dye, and the 3′end is labeled with Quencher Dye (MGB). The sequences of primers and TaqMan probe used in this study are listed in Table 1. The PCR products were sequenced on the amplified fragments of RIG-G gene to confirm the specificity of amplification. Used the BLAST function of the NCBI public database to conduct a preliminary test of primer efficacy against the target fragment of RIG-G to be amplified (the length is 286 bp).
+ Open protocol
+ Expand
6

Validating Differential Gene Expression in Natrinema

Check if the same lab product or an alternative is used in the 5 most similar protocols
A total of six genes that differentially expressed and related to the S-layer and energy metabolism of Natrinema sp. J7-2 in the RNA-seq analysis were selected for further validation using real-time RT-PCR. Real-time RT-PCR primers were designed by software Primer Premier 5.0 and synthesized by Invitrogen (Invitrogen, Shanghai) (S1 Table). Each 20μl reaction included 1μl of total RNA, 0.5 μmol L-1of each primer, 1.2 μl TakaRa Ex Taq HS Mix, 0.4 μl PrimeScript PLUS RTase Mix, and 10μl of 2× One step SYBR RT-PCR Buffer 4 (Roche). The reactions were subjected to reverse transcription at 42°C for 5 min, and 94°C for 10 s, then followed by 40 cycles each of 94°C for 5 s, 60°C for 25 s. The protocol concluded with a melting curve program using increasing increments of 0.5°C (10 s each; 68°C–99°C). Each gene was quantified relative to the calibrator. Calculations were made using the instrument and equation 2-ΔΔCt [35 (link)].
+ Open protocol
+ Expand
7

Real-Time PCR Assay for PCV3 Detection

Check if the same lab product or an alternative is used in the 5 most similar protocols
Primers and probes: The genome sequences of existing 58 PCV3 isolates were retrieved from the GenBank and aligned with Mega software version 6.0. The conserved region of PCV3 sequence was identified as the sequence of capsid, which was selected for designing the primers and probe. The candidate primers and probes were designed with the Primer Premier 5.0 and then synthesized (Invitrogen, Shanghai, China).
Reaction system: a total volume of 20 μL, including 10 μL of GoTaq® Probe qPCR Master Mix (2X); 1.2 μL of primers pair; 0.6 μL of probe; 2 μL of template, 6.2 μL of dH2O. The amplification procedure was as follows: 95 °C for 2 min; 40 cycles of 95 °C for 15 s and 60 °C for 1 min.
+ Open protocol
+ Expand
8

Investigating Genetic Variations in Goat SNX29

Check if the same lab product or an alternative is used in the 5 most similar protocols
We searched the Ensembl (https://asia.ensembl.org/) and Animal Omics database (http://animal.nwsuaf.edu.cn/), and found 11 InDel and five CNV loci of the SNX29 gene in goats. Then, 16 primer pairs for amplification were designed using the Primer-BLAST tool in the NCBI database (https://www.ncbi.nlm.nih.gov/tools/primer-blast/) and the primer premier 5.0 software (Thermo Scientific, Waltham, MA, USA) (Table 1). Besides, four pairs of primers including P1-Del-17bp (Rs659002477, TAAAGGAAAGCAATGTA/-), P2-Del-20bp (Rs654310334, AGCTTCCGGTGAGCCTGTCG/-) (30 (link)), MC1R, and GAPDH (30 (link), 31 (link)) were referred to our previous studies. MC1R and GAPDH were used as reference genes.
+ Open protocol
+ Expand
9

Goat PLAG1 Gene CNV Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
CNV loci were retrieved from the Animal Omics database (http://animal.nwsuaf.edu.cn/, accessed on 19 March 2022) [29 (link)], and we found three CNV loci of the PLAG1 gene in goats. Based on reference sequences (NC_030821.1), the primers for mRNA expression and CNV detection were then designed using the Primer-blast tool in the NCBI database (https://www.ncbi.nlm.nih.gov/tools/primer-blast/, accessed on 19 March 2022) and the Primer Premier 5.0 software (Thermo Scientific, Waltham, USA) (Table 1). The GAPDH gene was used as the reference gene for mRNA expression, and the MCIR gene was utilized as the reference gene for CNV detection. GAPDH and MC1R were referred to in a previous article [30 (link),31 (link)].
+ Open protocol
+ Expand
10

Quantifying Gene Expression in Cell Co-Culture

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from hTERT-HPNE or SW1990 cells cultured alone or co-cultured with NK cells using Trizol reagent and reverse-transcribed to cDNA using PrimeScript RT Master Mix (Perfect Real Time). The cDNA was amplified using Power SYBR Green PCR Master mix and the Step One Plus Real-Time PCR System (Applied Biosystems, Carlsbad, CA, USA). Each procedure was performed according to the manufacturer’s instructions. The sequences of gene specific primers for human MMP-9, IDO, COX-2, and β-actin were designed and purchased from Invitrogen (Carlsbad, CA, USA) using Primer Premier 5 and checked by Oligo 6 (Invitrogen). Expression levels were normalized relative to the cell line according to the formula 2-ΔΔCt, where Ct is the cycle threshold.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!